ORFeome > wbscr16 ORF1 – XORFeome v1.0

wbscr16 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: wbscr16
Gene ID: 963916
Gene Page ID: 963909
ORF Xenbase ID: 17304555

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097888
Original XGC clone length: 1350

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ837137
dbEST ID: 79654839
Trimmed Sequence: ATGTGGACTTCATTGTTCTTCAGAGGCCAGTGTATTCTGAAACGCAGAGGTCACCTTCAGAGACATTTGTCTGCAAGAGTTAGCAAAAGCAGAGAAGAAGATGATCTGCCAGTATTTCAATATGTGGGCGAGAGGTCGAAAAGGAAAGAACGGGTATTTGTTTGGGGATTTTCTTACACGGGAGCATTGGGCATCCCCAGTTTTGTTATTCCTGACACAGGAACAAAGAAACCTAAAAGATACCAGCTGACGCCCTACAGGTTGGAGATGGATGAAAAGATTTCATCAGCAGCCTGTGGCTATGGATTCACTCTACTATCTTCAAAAACTGCTAACATCTCAAAGATTTGGGGAATGGGTTTAAATAAGGATTCACAGATTGGATTTCACAGAAGCAGAAGAGATCGAACTAAAGGATATGAGTACATTCTGGAGCCATCTCCAGTCCCATTACCACTGGATAAGCCCCAGGAGACAAAAGTGTTGCAGGTGTCTTGTGGCCGAGCACATTCGCTTATACTGACAGACAAAGAAGGAGTTTTCAGCATGGGAAATAACTCTTACGGGCAGTGTGCACGAGAAGTTATTGAAGGAGAAATATATAGTGAAAGCCAGCTGATTCACAGGGTCAAAGAGCTGGATAACACAGTGGTTTCAGGGTTGCGTGTGGGTCAGACCACAGTTTGTTCAGGACAAAAAAAAGAGAAGTGTACTCCTGTGGAATGGGGAGCAAATGGGCAAACGGAACTGGGTCCATTTAATGGTGTGCACCAACCCAACCAAAGCTAGCCCGGGGAATATTGGGAGGTGTCCAATTTT
Full Trace Sequence: GGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGACTTCATTGTTCTTCAGAGGCCAGTGTATTCTGAAACGCAGAGGTCACCTTCAGAGACATTTGTCTGCAAGAGTTAGCAAAAGCAGAGAAGAAGATGATCTGCCAGTATTTCAATATGTGGGCGAGAGGTCGAAAAGGAAAGAACGGGTATTTGTTTGGGGATTTTCTTACACGGGAGCATTGGGCATCCCCAGTTTTGTTATTCCTGACACAGGAACAAAGAAACCTAAAAGATACCAGCTGACGCCCTACAGGTTGGAGATGGATGAAAAGATTTCATCAGCAGCCTGTGGCTATGGATTCACTCTACTATCTTCAAAAACTGCTAACATCTCAAAGATTTGGGGAATGGGTTTAAATAAGGATTCACAGATTGGATTTCACAGAAGCAGAAGAGATCGAACTAAAGGATATGAGTACATTCTGGAGCCATCTCCAGTCCCATTACCACTGGATAAGCCCCAGGAGACAAAAGTGTTGCAGGTGTCTTGTGGCCGAGCACATTCGCTTATACTGACAGACAAAGAAGGAGTTTTCAGCATGGGAAATAACTCTTACGGGCAGTGTGCACGAGAAGTTATTGAAGGAGAAATATATAGTGAAAGCCAGCTGATTCACAGGGTCAAAGAGCTGGATAACACAGTGGTTTCAGGGTTGCGTGTGGGTCAGACCACAGTTTGTTCAGGACAAAAAAAAGAGAAGTGTACTCCTGTGGAATGGGGAGCAAATGGGCAAACGGAACTGGGTCCATTTAATGGTGTGCACCAACCCAACCAAAGCTAGCCCGGGGAATATTGGGAGGTGTCCAATTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGACTTCATTGTTCTTCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837136
dbEST ID: 79654838
Trimmed Sequence: CATTAATGATTTCACAAGAGCCACCATATGGTCTACACCGCAAGCAACATCCACTATTTCTCCAGGAACAGTCACCCGCCAGGGAAAATACTGGTCTTCAAATCTTCCGGTACCTAAGCAGCCCCTCAAATTTTTGCCCCAAACAAACAACTCTCCTCGATTGTTCATTGCTGCAAAGTGTCCAAGACCAGAGAAGACCCTGGTTACCCTTATATCAGGATTAAAGTCAGACAGACCAAACAGGGATGGAGGAATCATTTCAGGTTGTTGGGCTTCTAAAAAATTTGGTCCTTTTCCAAGAATACCATATCCCCAGACGAAGACACTCCCATCTTCGTTTACAGCTATACAACCTGTGCCCCCGCAAGCAACCTGCTTCACCCTTCCGACATGCTGGAATGGTAAGTATCGTGGTACATTGACCTGTGTAGAATCCGTGACACATGCAAGCTGCATGTACTCAGAGTTTCCCCACCCAAACAGTTGTCCTTCCTCTGAGACTGCGAGGCAGCAATCCCCATAAATGGCTACCTGCATAATATTGACACCTGCCATATCACCGCCCAGCTTTTTTTGGGTTGCTGCACACATTAAAATGACCAAGTCCCTGTTGCCCATCTGCTCCCCATCCGCAAAAAATAACTTTCTCCTTTCTCTGCCCCGAAAAAAACGAGGTTCCTTGGCAGACCCCAACCTAAAACCCACAAATTTAACCAGCCTCTCTTTTACCTCTTTTAAATCCACCCGGCCTCTTTCCCCAAA
Full Trace Sequence: GAAAACGGCTATTGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATTAATGATTTCACAAGAGCCACCATATGGTCTACACCGCAAGCAACATCCACTATTTCTCCAGGAACAGTCACCCGCCAGGGAAAATACTGGTCTTCAAATCTTCCGGTACCTAAGCAGCCCCTCAAATTTTTGCCCCAAACAAACAACTCTCCTCGATTGTTCATTGCTGCAAAGTGTCCAAGACCAGAGAAGACCCTGGTTACCCTTATATCAGGATTAAAGTCAGACAGACCAAACAGGGATGGAGGAATCATTTCAGGTTGTTGGGCTTCTAAAAAATTTGGTCCTTTTCCAAGAATACCATATCCCCAGACGAAGACACTCCCATCTTCGTTTACAGCTATACAACCTGTGCCCCCGCAAGCAACCTGCTTCACCCTTCCGACATGCTGGAATGGTAAGTATCGTGGTACATTGACCTGTGTAGAATCCGTGACACATGCAAGCTGCATGTACTCAGAGTTTCCCCACCCAAACAGTTGTCCTTCCTCTGAGACTGCGAGGCAGCAATCCCCATAAATGGCTACCTGCATAATATTGACACCTGCCATATCACCGCCCAGCTTTTTTTGGGTTGCTGCACACATTAAAATGACCAAGTCCCTGTTGCCCATCTGCTCCCCATCCGCAAAAAATAACTTTCTCCTTTCTCTGCCCCGAAAAAAACGAGGTTCCTTGGCAGACCCCAACCTAAAACCCACAAATTTAACCAGCCTCTCTTTTACCTCTTTTAAATCCACCCGGCCTCTTTCCCCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATTAATGATTTCACAAGAGCCAC