ORFeome > wdr1 ORF1 – XORFeome v1.0

wdr1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: wdr1
Gene ID: 865912
Gene Page ID: 489896
ORF Xenbase ID: 17304579

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060007
Original XGC clone length: 1824

Human orthology & disease relationships

NCBI Entrez ID: 9948
Ensembl gene IDs: ENSG00000071127
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,104300,105120,108120,115200,123500,125853,131950,145980,182290,184500,211980,215600,226650,226670,600652,603278,604219,606595,607841,609285

Library Location

Plate ID: GDExl11018
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ824455
dbEST ID: 79642157
Trimmed Sequence: ATGCCTTATGAGATAAAGAAAGTGTTTGCCAGTCTCCCACAGGTGGAAAGAGGGGTGGCGAAAATTATCGCCGGAGACCCAAAGGGGAATAACTTTCTGTACACCAATGGGAAAAGTGTCATCATCAGGAATATCGATAACCCAGCTATTGCCGATATATACACTGAGCACGCCCATCAAGTTGTTGTTGCCCGATATGCTCCCAGTGGATTCTACATTGCATCTGGAGACACTTCTGGAAAGCTAAGGATCTGGGACACGACCCAGAAAGAGCACTTGCTAAAATATGAGTACCAGCCATTTGCAGGAAAGATTAAAGATATAGCTTGGACAGAGGATAGCAAGAGAATTGCTGTGGTGGGTGAAGGCCGGGAGAAGTTTGGATCTGTCTTTCTTTGGGACACTGGCTCCTCGGTTGGGGAAATTATTGGTAACATTAAAGTCATTAACTCTGTGGACATCAAACAGACAAGACCTTACCGCTTGGTGACCGGTAGTGATGACAACTGCTGCGCTTTCTTTGAAGGGCCACCTTTCAAATTCAAGTTTACCATGTCTGACCACAGTCGCTTTGTAAATTGTGTCCGATTCTCTCCGGATGGAAGCAGACTTGCCTCTGCTGGTGCTGATGGGCAGATTTTCCTTTATGATGGTAAGACCGGAGAAAAGGTCTGCAGTCTTGNAGGAAGTAAGCACACGATGGTGGAATTTATGCGGGTAGCTGGAGTCCTGATGGTACCCCACTGCCTTTCTGCATCCTGTGGCAAAACTGCAAAAAACCTGGGAAGTTT
Full Trace Sequence: CATTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTTATGAGATAAAGAAAGTGTTTGCCAGTCTCCCACAGGTGGAAAGAGGGGTGGCGAAAATTATCGCCGGAGACCCAAAGGGGAATAACTTTCTGTACACCAATGGGAAAAGTGTCATCATCAGGAATATCGATAACCCAGCTATTGCCGATATATACACTGAGCACGCCCATCAAGTTGTTGTTGCCCGATATGCTCCCAGTGGATTCTACATTGCATCTGGAGACACTTCTGGAAAGCTAAGGATCTGGGACACGACCCAGAAAGAGCACTTGCTAAAATATGAGTACCAGCCATTTGCAGGAAAGATTAAAGATATAGCTTGGACAGAGGATAGCAAGAGAATTGCTGTGGTGGGTGAAGGCCGGGAGAAGTTTGGATCTGTCTTTCTTTGGGACACTGGCTCCTCGGTTGGGGAAATTATTGGTAACATTAAAGTCATTAACTCTGTGGACATCAAACAGACAAGACCTTACCGCTTGGTGACCGGTAGTGATGACAACTGCTGCGCTTTCTTTGAAGGGCCACCTTTCAAATTCAAGTTTACCATGTCTGACCACAGTCGCTTTGTAAATTGTGTCCGATTCTCTCCGGATGGAAGCAGACTTGCCTCTGCTGGTGCTGATGGGCAGATTTTCCTTTATGATGGTAAGACCGGAGAAAAGGTCTGCAGTCTTGNAGGAAGTAAGCACACGATGGTGGAATTTATGCGGGTAGCTGGAGTCCTGATGGTACCCCACTGCCTTTCTGCATCCTGTGGCAAAACTGCAAAAAACCTGGGAAGTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTTATGAGATAAAGAAAGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829809
dbEST ID: 79647511
Trimmed Sequence: TTTGAAGGTGACTGTCCACTGTTTGACACATGCATCATGGGATACTGTAGCCAACGTGTTTTCATCCAACCAGGCCAAGCTGCTCACATGGTGTAGCCTATGGGCATCTGGCATTTTGATTCTTGTATCTGGATCACTCAAGGTCCAAACGTATACCATCATATCCATGCCGCTACTTGCAAAGTGCTCATTGTCAGGTGACCAGGCCACGGAAAGAGCTTTTGCATGGTGTCCGTAGTAACTGTTATGTTCCGAATATCCGTCTGCAACACTGAAGACTGTAACAACTTTGTTAGCATCGGTAACTGCAAGGAAGGCGCCATCAGGGGAATAGGCGAGGTCAGTCACTGCACCTTTTGCTGGTAAGGTCTTGCCTTCATCCTTCAAAGAATTTCCTTGAATCGAATACAGATGAACTTTCCCATCCGCTCCACCAACAGAAACCGTGCCAGAACCCTTATGAATTGCTACAGCCTCTGGTTCATAGTCCAAAGAGTCAATTGCAAAAACCTTTTTCTTGTCCTTCAGAAGAACAATCTGCCCAATGCACACAGTTACAACATATCCACCAGAGCCAACGGCAACACATTTAGGTTGAACATCCATTTTAACAGATTTCGAAGAACTGTAATCTTTGCTGATCAGATTGGTATAGCGTAGAGTATCATCCATGCTGCAAGTTATTAGCTGACTGGAAACATCCAGATCCATGCCTAAAAACCTGGTTGGGAATGACTTTTTCCCAAGTTAAAAGGTGTTGGTTCCC
Full Trace Sequence: CACGGAAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGAAGGTGACTGTCCACTGTTTGACACATGCATCATGGGATACTGTAGCCAACGTGTTTTCATCCAACCAGGCCAAGCTGCTCACATGGTGTAGCCTATGGGCATCTGGCATTTTGATTCTTGTATCTGGATCACTCAAGGTCCAAACGTATACCATCATATCCATGCCGCTACTTGCAAAGTGCTCATTGTCAGGTGACCAGGCCACGGAAAGAGCTTTTGCATGGTGTCCGTAGTAACTGTTATGTTCCGAATATCCGTCTGCAACACTGAAGACTGTAACAACTTTGTTAGCATCGGTAACTGCAAGGAAGGCGCCATCAGGGGAATAGGCGAGGTCAGTCACTGCACCTTTTGCTGGTAAGGTCTTGCCTTCATCCTTCAAAGAATTTCCTTGAATCGAATACAGATGAACTTTCCCATCCGCTCCACCAACAGAAACCGTGCCAGAACCCTTATGAATTGCTACAGCCTCTGGTTCATAGTCCAAAGAGTCAATTGCAAAAACCTTTTTCTTGTCCTTCAGAAGAACAATCTGCCCAATGCACACAGTTACAACATATCCACCAGAGCCAACGGCAACACATTTAGGTTGAACATCCATTTTAACAGATTTCGAAGAACTGTAATCTTTGCTGATCAGATTGGTATAGCGTAGAGTATCATCCATGCTGCAAGTTATTAGCTGACTGGAAACATCCAGATCCATGCCTAAAAACCTGGTTGGGAATGACTTTTTCCCAAGTTAAAAGGTGTTGGTTCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGAAGGTGACTGTCCACTGTT