ORFeome > wdr54 ORF1 – XORFeome v1.0

wdr54 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: wdr54
Gene ID: 6252791
Gene Page ID: 6457447
ORF Xenbase ID: 17304681

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123189
Original XGC clone length: 1014

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ838337
dbEST ID: 79656039
Trimmed Sequence: ATGTACCGGAAGGACAAGAGTATACAGATGAAGAGCAGTGCCTCGGCTCTATACAATAACCTCAGTGTCCTGCCAATCACTGACAAGAGTCTCACCTACTTCTCCGTTGTCCATGGCAACACGGTCAATATGGTCAGCGCTTCCGCCGACGGACTCAACTTCTCTCATCGACAACTGCAGTCCAAGGAGGGGAGTGTCACTGTTAGCTCCTCCCTCATCATGCAGGCATCATGGTGTGTTCTGCCAACGAGAGTACTGCTGGTTCTGACCTCACAGAAGGGAATTCAGATGTACGAATCAGACGGCTCCATTATGGTCTACTGGCACGCACTCGATGCCCTGGAAACCCCCCCAGCTCAGGCAGTGTTTGCCCGGGGTATCGCTCCTGCCAGGGGTCAGTACATCTGTGTAGGGACTTCCTCTGGATTGGTCCTCGTCTTTGACATCCCGGCCAAAGGCACCAACATCACCCTGGCAGAGGTTCTGGCTGAGCACAGGGAACCCATCACCGACATTGCCAGTGACTCTGCTACAGACAAGGACAGCGCTGCGGATCTGGTGACTGCTGATGACTCCGGGGCCCTGTGTGTTTGGAATTGTGGGGGGGGCGAGGAATTCAAACTACTTGACAAGATCTCTGCTTTCGGGGTTTCCTGCTCCCTCATGAATTTGTGGGATGGAATCATTGCTGGCTGCTTAGGGAAGGGGGCAAAATCGGGTTGTTTGAATGCGGAAAAGGGGCCCCCAAAATGTGAAAAGTTGGAAGGCCCAACCCCCCCCCGGAATTTTACCCCCTTCAAAATATTTCCCCCC
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTACCGGAAGGACAAGAGTATACAGATGAAGAGCAGTGCCTCGGCTCTATACAATAACCTCAGTGTCCTGCCAATCACTGACAAGAGTCTCACCTACTTCTCCGTTGTCCATGGCAACACGGTCAATATGGTCAGCGCTTCCGCCGACGGACTCAACTTCTCTCATCGACAACTGCAGTCCAAGGAGGGGAGTGTCACTGTTAGCTCCTCCCTCATCATGCAGGCATCATGGTGTGTTCTGCCAACGAGAGTACTGCTGGTTCTGACCTCACAGAAGGGAATTCAGATGTACGAATCAGACGGCTCCATTATGGTCTACTGGCACGCACTCGATGCCCTGGAAACCCCCCCAGCTCAGGCAGTGTTTGCCCGGGGTATCGCTCCTGCCAGGGGTCAGTACATCTGTGTAGGGACTTCCTCTGGATTGGTCCTCGTCTTTGACATCCCGGCCAAAGGCACCAACATCACCCTGGCAGAGGTTCTGGCTGAGCACAGGGAACCCATCACCGACATTGCCAGTGACTCTGCTACAGACAAGGACAGCGCTGCGGATCTGGTGACTGCTGATGACTCCGGGGCCCTGTGTGTTTGGAATTGTGGGGGGGGCGAGGAATTCAAACTACTTGACAAGATCTCTGCTTTCGGGGTTTCCTGCTCCCTCATGAATTTGTGGGATGGAATCATTGCTGGCTGCTTAGGGAAGGGGGCAAAATCGGGTTGTTTGAATGCGGAAAAGGGGCCCCCAAAATGTGAAAAGTTGGAAGGCCCAACCCCCCCCCGGAATTTTACCCCCTTCAAAATATTTCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACCGGAAGGACAAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838336
dbEST ID: 79656038
Trimmed Sequence: CATCTGTACATATCTAATGATCTCACCAAGGTCGTAGCCAGTCACAGCAAAGCTTCCCCCCTGGGGGTCACAGAATCGGGCCCCGCAGATCTGTGTGTCGGTCACACACTCGGAATGACAGTGCTCCACCTCAATTGTCCCACAGTCTGAGCGGCTCAACTGCCAGATCTGTATGAAGGAATCTTCTGCTCCAGAGAGAAGCTTCCCTGACTCGGGTGCAATATCGAGGGTGTAAATCCAGCGGGCGTGTGCATCCACCTCCACATTTAGGGCCCCTGTTGCCGCATCAAACACCCGAATCTGCCCCGTTCCATAAGCAGCAGCAATGACTCCATTCCACAACTTCACTGAGGAGCAGGAAACCCCGTAAGCAGAGATCTTGTTCAGTAGTTTGAATTCCTCGCCCCCCCCACACTTCCCAACACACAGGGCCCCGGAGTCATCAGCAGTCACCAGATCCGCAGCGCTGTCCTTGTCTGTAGCAGAGTCACTGGCAATGTCGGTGATGGGTTCCCTGTGCTCAGCCAAAACCTCTGCCAAGGTGATGTTGGTGCCTTTTGCCGGAATGTCAAAGAAGAAGAACCATCCAAAAGAAATTCCTTACACAAATGTACTTGACCCCTGGCAGGAACGAATACCCCGGGCAAACACCTGGCCGAAGCTTGGGGGGGTTTCCAGGGGCTTCGAAGGGGGTTGCCAGTTAAACCAATAATGGAAACCCGCCTGAAAATCCTAGAAATTTTGAAATTTCCCTTTTTTGTT
Full Trace Sequence: GGGAAACTGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCTAGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATCTGTACATATCTAATGATCTCACCAAGGTCGTAGCCAGTCACAGCAAAGCTTCCCCCCTGGGGGTCACAGAATCGGGCCCCGCAGATCTGTGTGTCGGTCACACACTCGGAATGACAGTGCTCCACCTCAATTGTCCCACAGTCTGAGCGGCTCAACTGCCAGATCTGTATGAAGGAATCTTCTGCTCCAGAGAGAAGCTTCCCTGACTCGGGTGCAATATCGAGGGTGTAAATCCAGCGGGCGTGTGCATCCACCTCCACATTTAGGGCCCCTGTTGCCGCATCAAACACCCGAATCTGCCCCGTTCCATAAGCAGCAGCAATGACTCCATTCCACAACTTCACTGAGGAGCAGGAAACCCCGTAAGCAGAGATCTTGTTCAGTAGTTTGAATTCCTCGCCCCCCCCACACTTCCCAACACACAGGGCCCCGGAGTCATCAGCAGTCACCAGATCCGCAGCGCTGTCCTTGTCTGTAGCAGAGTCACTGGCAATGTCGGTGATGGGTTCCCTGTGCTCAGCCAAAACCTCTGCCAAGGTGATGTTGGTGCCTTTTGCCGGAATGTCAAAGAAGAAGAACCATCCAAAAGAAATTCCTTACACAAATGTACTTGACCCCTGGCAGGAACGAATACCCCGGGCAAACACCTGGCCGAAGCTTGGGGGGGTTTCCAGGGGCTTCGAAGGGGGTTGCCAGTTAAACCAATAATGGAAACCCGCCTGAAAATCCTAGAAATTTTGAAATTTCCCTTTTTTGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATCTGTACATATCTAATGATCTC