ORFeome > wibg ORF1 – XORFeome v1.0

wibg ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: wibg
Gene ID: 943127
Gene Page ID: 943121
ORF Xenbase ID: 17304795

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082679
Original XGC clone length: 600

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ839806
dbEST ID: 79657508
Trimmed Sequence: ATGGCGGCTCCTTATGTTTCCGATGACTCCGGGAAGTACATAGCATCCACTCAGCGACCAGACGGTTCCTGGAGGAAGCAGAGAAAAGTGAAGGAGGGATATGTGCCCCAAGAAGAAGTACCAGTGTATGAAAATAAATATGTCAAGTTCTTCAAAAGCAAACCTTCTCTGCCTCCTGGTCTTTGTGAAGCCGATGGCACTACAGGCCAAGCCCAGCCTTCAAAGCCTGATGCTGACGCCAGCTTGTCCAAAACAGCCAAGAGGAACTTGAAGCGCAAAGAGAAAAGGAAACAAGAGAAAGGGGAACGCGAGCAGGTGGAAGAAACACGACAAGATCTGGAGAGGGTTAACATTTCAGATACCCCTGTGCAAAAGAATGTGACATCAGCACATAAGAATGGCTCAGCAAGCAGTGACAACTCTGCAGCAGAGAAGGCCAAGAAAATAAAGAACCTACGCAAAAAGCTTCGTCAGGTGGAGGAATTACAACAGAAAATAGACTGTGGGGAGATCATACAGCCATCCNAAGAGCAACTCGAAAAACTGGCCAGGAGGAAAGCTTTAGAAGATGAGATAGAGGACCTAGAGCTGGACTTATT
Full Trace Sequence: GCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTCCTTATGTTTCCGATGACTCCGGGAAGTACATAGCATCCACTCAGCGACCAGACGGTTCCTGGAGGAAGCAGAGAAAAGTGAAGGAGGGATATGTGCCCCAAGAAGAAGTACCAGTGTATGAAAATAAATATGTCAAGTTCTTCAAAAGCAAACCTTCTCTGCCTCCTGGTCTTTGTGAAGCCGATGGCACTACAGGCCAAGCCCAGCCTTCAAAGCCTGATGCTGACGCCAGCTTGTCCAAAACAGCCAAGAGGAACTTGAAGCGCAAAGAGAAAAGGAAACAAGAGAAAGGGGAACGCGAGCAGGTGGAAGAAACACGACAAGATCTGGAGAGGGTTAACATTTCAGATACCCCTGTGCAAAAGAATGTGACATCAGCACATAAGAATGGCTCAGCAAGCAGTGACAACTCTGCAGCAGAGAAGGCCAAGAAAATAAAGAACCTACGCAAAAAGCTTCGTCAGGTGGAGGAATTACAACAGAAAATAGACTGTGGGGAGATCATACAGCCATCCNAAGAGCAACTCGAAAAACTGGCCAGGAGGAAAGCTTTAGAAGATGAGATAGAGGACCTAGAGCTGGACTTATTGCCAACTTTCTTGGTACAAGTTGGCAGGATAAGAGAGCATTGCTTATCAATTTTGTTGCAACGACAGGGTCATATCAGTCAAAATAAAATCATTATTTGCCATCCAGCCTAAATCCCCAATATTGAGTCCTATTACTTGGTCTAAGCTGGTATAAAAGAAAAAAAAAAAAAAAGAGTCCAAAAAAAAACAAAAAAAAGCTTAAAAAAN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTCCTTATGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839805
dbEST ID: 79657507
Trimmed Sequence: TAAGTCCAGCTCTAGGTCCTCTATCTCATCTTCTAAAGCTTTCCTCCTGGCCAGTTTTTCGAGTTGCTCTTTGGATGGCTGTATGATCTCCCCACAGTCTATTTTCTGTTGTAATTCCTCCACCTGACGAAGCTTTTTGCGTAGGTTCTTTATTTTCTTGGCCTTCTCTGCTGCAGAGTTGTCACTGCTTGCTGAGCCATTCTTATGTGCTGATGTCACATTCTTTTGCACAGGGGTATCTGAAATGTTAACCCTCTCCAGATCTTGTCGTGTTTCTTCCACCTGCTCGCGTTCCCCTTTCTCTTGTTTCCTTTTCTCTTTGCGCTTCAAGTTCCTCTTGGCTGTTTTGGACAAGCTGGCGTCAGCATCAGGCTTTGAAGGCTGGGCTTGGCCTGTAGTGCCATCGGCTTCACAAAGACCAGGAGGCAGAGAAGGTTTGCTTTTGAAGAACTTGACATATTTATTTTCATACACTGGTACTTCTTCTTGGGGCACATATCCCTCCTTCACTTTTCTCTGCTTCCTCCAGGAACCGTCTGGTCGCTGAGTGGATGCTATGTACTTTCCCGAGTCATCGGAAACATAAGGAGCCGCCATGG
Full Trace Sequence: GGGGAAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAAGTCCAGCTCTAGGTCCTCTATCTCATCTTCTAAAGCTTTCCTCCTGGCCAGTTTTTCGAGTTGCTCTTTGGATGGCTGTATGATCTCCCCACAGTCTATTTTCTGTTGTAATTCCTCCACCTGACGAAGCTTTTTGCGTAGGTTCTTTATTTTCTTGGCCTTCTCTGCTGCAGAGTTGTCACTGCTTGCTGAGCCATTCTTATGTGCTGATGTCACATTCTTTTGCACAGGGGTATCTGAAATGTTAACCCTCTCCAGATCTTGTCGTGTTTCTTCCACCTGCTCGCGTTCCCCTTTCTCTTGTTTCCTTTTCTCTTTGCGCTTCAAGTTCCTCTTGGCTGTTTTGGACAAGCTGGCGTCAGCATCAGGCTTTGAAGGCTGGGCTTGGCCTGTAGTGCCATCGGCTTCACAAAGACCAGGAGGCAGAGAAGGTTTGCTTTTGAAGAACTTGACATATTTATTTTCATACACTGGTACTTCTTCTTGGGGCACATATCCCTCCTTCACTTTTCTCTGCTTCCTCCAGGAACCGTCTGGTCGCTGAGTGGATGCTATGTACTTTCCCGAGTCATCGGAAACATAAGGAGCCGCCATGGTGCCAACTTTTTTTGAAAAAGTTGGCATTATAAAAAAGCATTGCTCAATCATTTTTGTGCAAAAAAAAAGATAACTAAAAATAAAAAATAAAAAAATTAATTTGGGGGCCGAAAAATAAAAACTGCGCGTCTTATATACACCCTCCTCTTGTGAGAAAGGGGGGGGGGGGGCGAGAGGAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAGTCCAGCTCTAGGTC