ORFeome > wtap ORF1 – XORFeome v1.0

wtap ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: wtap
Gene ID: 864912
Gene Page ID: 482821
ORF Xenbase ID: 17304891

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099007
Original XGC clone length: 1182

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ838410
dbEST ID: 79656112
Trimmed Sequence: ATGACCAACGAAGAACCTCTCCCAAAAAAGGTTCGTCTCAACGAATCTGACTTTAAGGTCTTACCCAGAGAAGATCTATTGCAAAGGTGGAAACAATATGAAGCTTATGTGCAAGCTCTGGAAAATAAATACACAGATCTTAACTCTAATGATGTCACTGGACTGAGGGAGTCTGAGGAGAAGCTGAAGCAGCAACAGCAGGAATCTGCCCGAAGAGAAAATATATTGGTGATGAGACTGGCCACAAAGGAACAGGAGATGCAGGAATGCACGAATCAGATACAGCATCTCAAGCAAGTACAGCAGCCAAGTGTTGCCCAGCTGAGAGCAACTATGGTCGACCCTGCCATCAACTTGTTTTTCATCAAAATGAAAGCGGAACTGGAACAGACAAAAGACAAACTGGAACAAGCCCAAAATGAACTGAGTGCCTGGAAATTTACGCCTGATAGCCAAACAGGCAAAAAGCTAATGGCAAAGTGTCGAATGCTTATCCAAGAGAACCAGGAGCTGGGGAGGCAGCTGTCCCAAGGACGCATTGCCCAACTTGAGGCTGAGTTGGCTTTGCAGAAGAAATATAGTGAGGAACTTAAAAGCAGCCAAGATGAACTAGATGACTTCATCATTCAGTTGGATGAGGAAGGTGGGAAGGAATGCAGAGCACTATCTTTAGTTCTGCAGCAACAGCTGAAAGACTCCCCGTCAGCAGTTATCCCAATTTCCAGCAACAAAATCCAAATA
Full Trace Sequence: GGGGGCCCATATAATGGATTTTATTTNTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCAACGAAGAACCTCTCCCAAAAAAGGTTCGTCTCAACGAATCTGACTTTAAGGTCTTACCCAGAGAAGATCTATTGCAAAGGTGGAAACAATATGAAGCTTATGTGCAAGCTCTGGAAAATAAATACACAGATCTTAACTCTAATGATGTCACTGGACTGAGGGAGTCTGAGGAGAAGCTGAAGCAGCAACAGCAGGAATCTGCCCGAAGAGAAAATATATTGGTGATGAGACTGGCCACAAAGGAACAGGAGATGCAGGAATGCACGAATCAGATACAGCATCTCAAGCAAGTACAGCAGCCAAGTGTTGCCCAGCTGAGAGCAACTATGGTCGACCCTGCCATCAACTTGTTTTTCATCAAAATGAAAGCGGAACTGGAACAGACAAAAGACAAACTGGAACAAGCCCAAAATGAACTGAGTGCCTGGAAATTTACGCCTGATAGCCAAACAGGCAAAAAGCTAATGGCAAAGTGTCGAATGCTTATCCAAGAGAACCAGGAGCTGGGGAGGCAGCTGTCCCAAGGACGCATTGCCCAACTTGAGGCTGAGTTGGCTTTGCAGAAGAAATATAGTGAGGAACTTAAAAGCAGCCAAGATGAACTAGATGACTTCATCATTCAGTTGGATGAGGAAGGTGGGAAGGAATGCAGAGCACTATCTTTAGTTCTGCAGCAACAGCTGAAAGACTCCCCGTCAGCAGTTATCCCAATTTCCAGCAACAAAATCCAAATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCAACGAAGAACCTCTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838409
dbEST ID: 79656111
Trimmed Sequence: CAAAACAGAACCCTGTACATTTACACTGGAGTCCAAACCGTTTTGAAGGTGACGGGAGCTTACAGTTCTATTGCCTTTTCCACTCACTGGCTTCTCTTCCTGGGAGTCATGATTTGAGTCTGTGTCATTGGACTGGTGAGTTAGAGAGTTCTCACTGCCAGTTGGGGAATCTACACTTTCATACCCAGTACTAAGTGGATTAATATAGCTGCTCCCATCTCTACTAGTTCTCTCTTGTGAATGGTTTGAGAGCTTTCCCTCATTGATAGGTGAGGCTGAGAAATCATCTTCTGTGCTACTGCCCTCCCTATAAAGACCAGCTGAGCTGTGTGTTCTCTGAAGGGAAGAGCCACCATTGCTTGGTCCATTTAGTATGCGGCCACAATCCTTTCCAGATGTCTCACCCTCATCCTTGGGTTCTGACGAAGGAGTCCTGTTACCAGATATTTGGATCTGTTGCTGAGACTGGGATAACTGCTGACGGGAGTCTTTCAACTGTTGCTGCATAACTAAGATAGTGCTCTGCATTCCTTCCACCTCCTCATCAAGCTGAAATGATGAAATCATTTAGTTCATCTTGGCTGCTTTTAATTTCCTCACTAGATTTCCTTCTCCAAGCCAACTCAGCCCTCAATTTGGGCAAATGCGTCCTTGGGAACAGCTCCCTCCCCCCCCTCCGGGTTCTCTTTGGAAAAGCC
Full Trace Sequence: GGGTATTATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAAACAGAACCCTGTACATTTACACTGGAGTCCAAACCGTTTTGAAGGTGACGGGAGCTTACAGTTCTATTGCCTTTTCCACTCACTGGCTTCTCTTCCTGGGAGTCATGATTTGAGTCTGTGTCATTGGACTGGTGAGTTAGAGAGTTCTCACTGCCAGTTGGGGAATCTACACTTTCATACCCAGTACTAAGTGGATTAATATAGCTGCTCCCATCTCTACTAGTTCTCTCTTGTGAATGGTTTGAGAGCTTTCCCTCATTGATAGGTGAGGCTGAGAAATCATCTTCTGTGCTACTGCCCTCCCTATAAAGACCAGCTGAGCTGTGTGTTCTCTGAAGGGAAGAGCCACCATTGCTTGGTCCATTTAGTATGCGGCCACAATCCTTTCCAGATGTCTCACCCTCATCCTTGGGTTCTGACGAAGGAGTCCTGTTACCAGATATTTGGATCTGTTGCTGAGACTGGGATAACTGCTGACGGGAGTCTTTCAACTGTTGCTGCATAACTAAGATAGTGCTCTGCATTCCTTCCACCTCCTCATCAAGCTGAAATGATGAAATCATTTAGTTCATCTTGGCTGCTTTTAATTTCCTCACTAGATTTCCTTCTCCAAGCCAACTCAGCCCTCAATTTGGGCAAATGCGTCCTTGGGAACAGCTCCCTCCCCCCCCTCCGGGTTCTCTTTGGAAAAGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAACAGAACCCTGTACATTTAC