ORFeome > xbp1 ORF1 – XORFeome v1.0

xbp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: xbp1
Gene ID: 487128
Gene Page ID: 487123
ORF Xenbase ID: 17304927

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043852
Original XGC clone length: 1191

Human orthology & disease relationships

NCBI Entrez ID: 7494
Ensembl gene IDs: ENSG00000100219
Directly associated (OMIM) disease MIM numbers: 612371
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ823862
dbEST ID: 79641564
Trimmed Sequence: ATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCACGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGGAAGAAGAAGAAGAAGAATCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGAAGAATCAGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGGACCCCCATCAGCCAAGCTGGGACGCCCATTAATGGAACTGATCCCGATTTCGATCCACT
Full Trace Sequence: TATTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCACGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTTAGCACCCTGGAGTTAAAGGAAGAAGAAGAAGAAGAATCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAGAGCTCAAGGGAGAAGAATCAGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGGACCCCCATCAGCCAAGCTGGGACGCCCATTAATGGAACTGATCCCGATTTCGATCCACT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGTCGTGGGAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ829170
dbEST ID: 79646872
Trimmed Sequence: AAAATGTACATCAAACTCTGAGCTATGACTCCAGAAAGAAACGGCATCAACAGGAGATGAAGGACAAATGGATTGGTCCATATGGGCACTGAGGAGAAGCTGGGGGAAAAGTTCGGTACTGAACGAGTCTTCCCAAACCCGGTCAGAGTTCAGAGGAGAGGACAGGTCACTGAAGGGTGAAGAACACCCTTCATAGCCAGAGTCACTTCCTGTATCCAATATGTTAGATGATTTTTCAAGGTTGTTTTCAGAACAGGGCAAAAAGCTTTGCATTCCGAGGATGGGGACTAGGTCATCTTCTTGTGGTTCCTGTTTCACACAGGTCAGGTCATCTTCGCAGGTAGGGCTGAAAGATGCTTCCTCCATTTTAACTACTATGCTGGTCTCAACACCTTGCGCAGAGTCTTCCTCTGTGCTTAGTGGCTTGGTGTACACGTGATCGAATCGGATCAGTTCATTAATGGCGTCCAGCTTGGCTGATGGGGTCCCCACAGGAGAAGATGGGGAGGAGGATATGGAATCTGATTCTTCTCCCTTGAGCTCTTCATCTGGGCTTCCAGCAAGTGCTCCTTCATAGGCAAGCAACAAGTCTGAGTCCAGGCTTTCCAGAAAAGCCCACAAGAGATCAGACTCAGAGTCTGAAGTGTCAGGGCTGTCAAGATCCATGTAGACACTGTCAAGTTCAGAGACATCTGGGGCTGCCTCTTGCTGCCGAACTCAGCGGGAACCCGGTTTTTCCGGCCCTTGAACTT
Full Trace Sequence: GCTGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAATGTACATCAAACTCTGAGCTATGACTCCAGAAAGAAACGGCATCAACAGGAGATGAAGGACAAATGGATTGGTCCATATGGGCACTGAGGAGAAGCTGGGGGAAAAGTTCGGTACTGAACGAGTCTTCCCAAACCCGGTCAGAGTTCAGAGGAGAGGACAGGTCACTGAAGGGTGAAGAACACCCTTCATAGCCAGAGTCACTTCCTGTATCCAATATGTTAGATGATTTTTCAAGGTTGTTTTCAGAACAGGGCAAAAAGCTTTGCATTCCGAGGATGGGGACTAGGTCATCTTCTTGTGGTTCCTGTTTCACACAGGTCAGGTCATCTTCGCAGGTAGGGCTGAAAGATGCTTCCTCCATTTTAACTACTATGCTGGTCTCAACACCTTGCGCAGAGTCTTCCTCTGTGCTTAGTGGCTTGGTGTACACGTGATCGAATCGGATCAGTTCATTAATGGCGTCCAGCTTGGCTGATGGGGTCCCCACAGGAGAAGATGGGGAGGAGGATATGGAATCTGATTCTTCTCCCTTGAGCTCTTCATCTGGGCTTCCAGCAAGTGCTCCTTCATAGGCAAGCAACAAGTCTGAGTCCAGGCTTTCCAGAAAAGCCCACAAGAGATCAGACTCAGAGTCTGAAGTGTCAGGGCTGTCAAGATCCATGTAGACACTGTCAAGTTCAGAGACATCTGGGGCTGCCTCTTGCTGCCGAACTCAGCGGGAACCCGGTTTTTCCGGCCCTTGAACTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAATGTACATCAAACTCTGAGCT