ORFeome > xbp1 ORF2 – XORFeome v1.0

xbp1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: xbp1
Gene ID: 487128
Gene Page ID: 487123
ORF Xenbase ID: 17304933

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110723
Original XGC clone length: 765

Human orthology & disease relationships

NCBI Entrez ID: 7494
Ensembl gene IDs: ENSG00000100219
Directly associated (OMIM) disease MIM numbers: 612371
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11066
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ834292
dbEST ID: 79651994
Trimmed Sequence: ATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAAAGAAAGAAGAAGAAGAAGAATCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAAAGCTCAAGGGAAAAGAATCAAATTCCATATCCCTCCTCCCCATCTTTCTCCTGGGGGGGAACCCCTTCAGCCCAAGCCTGGGAACGCCCTTTAATGAAAACTTTGCCCAATCTTTTTCTTGGGT
Full Trace Sequence: CGCGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATTCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCATAAGCAGCCCGAGCAGTCCGGAGTCCGTCAGCAATGAGCAACCCCCAAGGAAGAGACAGAGACTCACCCACCTTAGCTCGGAGGAAAAAGCGCTTAGAAGAAAATTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTGGAACAGCAAGTGATAGATTTAGAAATGGAGAATGAGAAGCTTTTAATTGAAAACCAGATTTTAAGAGAAAAATCTCATGGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTGGGCCTAAGCACCCTGGAGTTAAAGAAAGAAGAAGAAGAAGAATCACAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCTGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGGAGCACTTGCTGGAAGCCCAGATGAAAAGCTCAAGGGAAAAGAATCAAATTCCATATCCCTCCTCCCCATCTTTCTCCTGGGGGGGAACCCCTTCAGCCCAAGCCTGGGAACGCCCTTTAATGAAAACTTTGCCCAATCTTTTTCTTGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGTCGTGGGAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ834293
dbEST ID: 79651995
Trimmed Sequence: GTTCATTAATGGCGTCCAGCTTGGCTGATGGGGTCCCCACAGGAGAAGATGGGGAGGAGGATATGGAATCTGATTCTTCTCCCTTGAGCTCTTCATCTGGGCTTCCAGCAAGTGCTCCTTCATAGGCAAGCAACAAGTCTGAGTCCAGGCTTTCCAGAAGGCCCAACAAGAGATCAGACTCAGAGTCTGAAGTGTCAGGGCTGTCAGGATCCATGTAGACACTGTCAGGTTCAGAGACATCTGGGCCTGCTCCTGCTGCAGAGGGGCACATAGTCTGAGTGCTGCGGACTCAGCGGACCCGGTCTCCGGCCTGACTTTATCTTTTCTGGACTGATTCAGCTCCTGTGATTCTTCTTCTTCTTCTTTCTTTAACTCCAGGGTGCTTAGGCCCAATCTTTGGCGTAGCTCCTGGTTTTCAGTCAACAAGCCATGAGATTTTTCTCTTAAAATCTGGTTTTCAATTAAAAGCTTCTCATTCTCCATTTCTAAATCTATCACTTGCTGTTCCAGTTCACTCATTCTGGCTTTTTTCCTGTCCCGAGCAGTCTGTGCTGCTACTCTGTTTTTTAATTTTCTTCTAAGCGCTTTTTCCTCCGAGCTAAGGTGGGTGAGTCTCTGTCTCTTCCTTGGGGGTTGCTCATTGCTGAACGGACTCCGAACGGGTCGGGCTGCTTATGGGTAACATTACGGAACCCAAGGCGTTCGCCCTGCTCAACCTGATTCCCCGGGAAAAAAGAATTCCTTTGGGGGGCCCCCC
Full Trace Sequence: GGCCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTCATTAATGGCGTCCAGCTTGGCTGATGGGGTCCCCACAGGAGAAGATGGGGAGGAGGATATGGAATCTGATTCTTCTCCCTTGAGCTCTTCATCTGGGCTTCCAGCAAGTGCTCCTTCATAGGCAAGCAACAAGTCTGAGTCCAGGCTTTCCAGAAGGCCCAACAAGAGATCAGACTCAGAGTCTGAAGTGTCAGGGCTGTCAGGATCCATGTAGACACTGTCAGGTTCAGAGACATCTGGGCCTGCTCCTGCTGCAGAGGGGCACATAGTCTGAGTGCTGCGGACTCAGCGGACCCGGTCTCCGGCCTGACTTTATCTTTTCTGGACTGATTCAGCTCCTGTGATTCTTCTTCTTCTTCTTTCTTTAACTCCAGGGTGCTTAGGCCCAATCTTTGGCGTAGCTCCTGGTTTTCAGTCAACAAGCCATGAGATTTTTCTCTTAAAATCTGGTTTTCAATTAAAAGCTTCTCATTCTCCATTTCTAAATCTATCACTTGCTGTTCCAGTTCACTCATTCTGGCTTTTTTCCTGTCCCGAGCAGTCTGTGCTGCTACTCTGTTTTTTAATTTTCTTCTAAGCGCTTTTTCCTCCGAGCTAAGGTGGGTGAGTCTCTGTCTCTTCCTTGGGGGTTGCTCATTGCTGAACGGACTCCGAACGGGTCGGGCTGCTTATGGGTAACATTACGGAACCCAAGGCGTTCGCCCTGCTCAACCTGATTCCCCGGGAAAAAAGAATTCCTTTGGGGGGCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTCATTAATGGCGTCCAG