ORFeome > xiap ORF1 – XORFeome v1.0

xiap ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: xiap
Gene ID: 948852
Gene Page ID: 948845
ORF Xenbase ID: 17304951

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141765
Original XGC clone length: 1428

Human orthology & disease relationships

NCBI Entrez ID: 331
Ensembl gene IDs: ENSG00000101966,ENSG00000270294,LRG_19
Directly associated (OMIM) disease MIM numbers: 300635
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,114480,132600,155255,259500,600376,609048,609192

Library Location

Plate ID: GDExl11091
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ838863
dbEST ID: 79656565
Trimmed Sequence: ATGACATGCCAGTGTCCAAAGATGTCAGACAGTGCTTGTGATGTGGACACGGACCAGAATTATTTTGAAGAGGAAGTCAGACTGGCCTCCTTTGCTAATTTTTCAAGTAGCTACCCTGTTTCTGCCCCAGCACTAGCACGGGCCGGCTTTTATTACACTGGAGATGGAGACCGAGTAAAGTGTTTTAGCTGTATGGCTATGGTCGAAGATTGGCAGCATGGAGACACGGCAATCGGCAAGCATCGGAAAATATCTCCAAACTGTAAATTCATTAACGGCTTTAATAACTTCCGAAGCGATTGTATCCAAACTCAAGCTCCTGTCATGCAGAATTCTCATGCCAATGGTTTCCCAAATTCTGCTGAAGACCCGGGTGAGAAATCTAGTTCTGAGATTATGGCAGACTACATGCTAAGGACTGGAAGAGTTGTCGATATGTCGAAACCAAAATACCCCAGACACATGGCAATGTGTAGTGAGGAAGCCAGACTGCAGACATTTCAAAACTGGCCAGGCTATTCCCCCGTTAATGCCAAAAGAGCTTGCCCATGCAGGTCTCTTTTATACTGGCATCAACGACCAAGTCCAATTGCTTTTGTTGTGGTGGAAAAACTAATAAACTGGGGAACTAGTGACCTAACCCTTGGACGAACACAAAAAAACATTTCCCCCAAGCCTTTTTTGTTTTTGGAAGTTGATTTTTGGGGTTGTGACAAAAAATGGCCGGTGTGCAAGGGCAGTTCTTACTTGAAACACTAACAAATGCCCCTCTCTTGGGCCCCTTTTTCCTCGGGGCTCCCTTTTCCCAATTTTGGCGAAGGAAAA
Full Trace Sequence: TCGTGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACATGCCAGTGTCCAAAGATGTCAGACAGTGCTTGTGATGTGGACACGGACCAGAATTATTTTGAAGAGGAAGTCAGACTGGCCTCCTTTGCTAATTTTTCAAGTAGCTACCCTGTTTCTGCCCCAGCACTAGCACGGGCCGGCTTTTATTACACTGGAGATGGAGACCGAGTAAAGTGTTTTAGCTGTATGGCTATGGTCGAAGATTGGCAGCATGGAGACACGGCAATCGGCAAGCATCGGAAAATATCTCCAAACTGTAAATTCATTAACGGCTTTAATAACTTCCGAAGCGATTGTATCCAAACTCAAGCTCCTGTCATGCAGAATTCTCATGCCAATGGTTTCCCAAATTCTGCTGAAGACCCGGGTGAGAAATCTAGTTCTGAGATTATGGCAGACTACATGCTAAGGACTGGAAGAGTTGTCGATATGTCGAAACCAAAATACCCCAGACACATGGCAATGTGTAGTGAGGAAGCCAGACTGCAGACATTTCAAAACTGGCCAGGCTATTCCCCCGTTAATGCCAAAAGAGCTTGCCCATGCAGGTCTCTTTTATACTGGCATCAACGACCAAGTCCAATTGCTTTTGTTGTGGTGGAAAAACTAATAAACTGGGGAACTAGTGACCTAACCCTTGGACGAACACAAAAAAACATTTCCCCCAAGCCTTTTTTGTTTTTGGAAGTTGATTTTTGGGGTTGTGACAAAAAATGGCCGGTGTGCAAGGGCAGTTCTTACTTGAAACACTAACAAATGCCCCTCTCTTGGGCCCCTTTTTCCTCGGGGCTCCCTTTTCCCAATTTTGGCGAAGGAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACATGCCAGTGTCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838862
dbEST ID: 79656564
Trimmed Sequence: TGACATAAAAATTTTTTGTCTTCTTTCTATAATAGTGCAACAGATTGGACATTTATCAAGCACATCCGCACATACAGCACATGCCACAAGATGGCCGCAGGGTATGAAAACAATGGTGATCCGTCTGTCCATACAAACTTTGCAGACCTTCTCCTCCTCTAGTTGTCTCAGTTTCTCTTCAATGCTGATCTCCCTTTTCATAGGCTTATCTGCGATTGTTTCACTCTGAGCACATAACAAGTCTGAGACAAATTCTTCCACACATGTATAATTATTCCCTGTGGTCTTCAGTTTCTGCCCCATAACTTTCTTAATTTCTTCGAGGGGAAATCCCATTTGCTGGGCATAGATCACCAAAGGGTTCTTCAAGAAACTCGTATCCTTGGGTAATGCAGGTGATGCTTCTCCAGAGTTTGCCTTGTGCAGAATAGGTCTCTGTAACTGGGCATTATTTATAAATTGCTGTCCCTTTTCTTCTATCAGGAACTGGCATCCAGGATATGCCTTTGCATGCTCTTCCCAAGGATCGTCGTTTGCTGCCCAACAATTTAACATTCCCCCACAAGAAAAGCATTTTGTAGCATCTTCATCACCTATCCTATAAAATCCACCTTTTACGAATGTTTCCTTGTCATTGGAAAATGGCCATTGATAAAAAGGCCTCAAGAACAACAATTGTACCTGTTTCTGTTTGTAATTGCTTTGCACACCTGCCACCCCCCCGGCCCATTTGCCCCACCATCCCCTTCCCCAAAAACAAAATAAAAAA
Full Trace Sequence: GGGAAAATGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGACATAAAAATTTTTTGTCTTCTTTCTATAATAGTGCAACAGATTGGACATTTATCAAGCACATCCGCACATACAGCACATGCCACAAGATGGCCGCAGGGTATGAAAACAATGGTGATCCGTCTGTCCATACAAACTTTGCAGACCTTCTCCTCCTCTAGTTGTCTCAGTTTCTCTTCAATGCTGATCTCCCTTTTCATAGGCTTATCTGCGATTGTTTCACTCTGAGCACATAACAAGTCTGAGACAAATTCTTCCACACATGTATAATTATTCCCTGTGGTCTTCAGTTTCTGCCCCATAACTTTCTTAATTTCTTCGAGGGGAAATCCCATTTGCTGGGCATAGATCACCAAAGGGTTCTTCAAGAAACTCGTATCCTTGGGTAATGCAGGTGATGCTTCTCCAGAGTTTGCCTTGTGCAGAATAGGTCTCTGTAACTGGGCATTATTTATAAATTGCTGTCCCTTTTCTTCTATCAGGAACTGGCATCCAGGATATGCCTTTGCATGCTCTTCCCAAGGATCGTCGTTTGCTGCCCAACAATTTAACATTCCCCCACAAGAAAAGCATTTTGTAGCATCTTCATCACCTATCCTATAAAATCCACCTTTTACGAATGTTTCCTTGTCATTGGAAAATGGCCATTGATAAAAAGGCCTCAAGAACAACAATTGTACCTGTTTCTGTTTGTAATTGCTTTGCACACCTGCCACCCCCCCGGCCCATTTGCCCCACCATCCCCTTCCCCAAAAACAAAATAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGACATAAAAATTTTTTGTCTTCT