ORFeome > xpa ORF1 – XORFeome v1.0

xpa ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: xpa
Gene ID: 977987
Gene Page ID: 977980
ORF Xenbase ID: 17304993

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123173
Original XGC clone length: 798

Human orthology & disease relationships

NCBI Entrez ID: 7507
Ensembl gene IDs: ENSG00000136936,ENSG00000231521,LRG_471
Directly associated (OMIM) disease MIM numbers: 278700
Indirectly associated (Lage, et al.) disease MIM numbers: 214150,216400,601675

Library Location

Plate ID: GDExl11087
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ838133
dbEST ID: 79655835
Trimmed Sequence: ATGGAGCCAGAACCAGAGCAAGAAGCTAATAAGGAAGAAGAGAAGATACTTTCTGCTGCAGTCCGAGCTAAGATAGAACGCAATAGGCAAAGGGCACTTATGCTGAGACAGGCCAGGCTGGCATGCAGGCCCTATCCCACTGGTGAAGGTATTTCTACAGTTAAAGCACCTCCAAAAGTGATTGATTCAGGAGGAGGATTTTTTATAGAAGAGGAGGAAGCAGAGGAGCAACATGTTGAAAATGTGGTCCGTCAACCTGGACCTGTTCTGGAATGTGATTATCTCATTTGTGAAGAGTGTGGCAAAGATTTTATGGATTCCTACTTAAGCAATCACTTTGACCTAGCAGTCTGCGACAGTTGCAGAGATGCAGAAGAAAAGCACAAACTAATAACGCGTACTGAAGCCAAGCAGGAGTATTTGCTGAAAGACTGCGACGTTGACAAAAGGGAACCAGTTCTAAAATTCATATTAAAGAAAAACCCTCATAACACTCATTGGGGAGACGTGAAACTTTACCTTAAAGCACAGGTAATTAAACGATCACTATAAGTATGGGGCTCTGAGGAAGCTCTTGAAGAAGCAAAGGAGGTACGAAAAGATAACCGAGACCAGATGAAACAAAAGAAATTTGACTAAAAGGTCAAAGAACTGCTTCGTACTGGTGAGGAAAATTTTGTGGAGGAAAGAAGCCAGTGGGCGCCCGCGTGAATAATGGACGGGAGAGGCGGGTAGAGGAAGAAGCGAGAGAAGAAAAAAGCGAAAAACGGGGGCGTTAAAAGTGGGGGGTGGAAAGGGTGTTGGGGAGGTTTGGGGGGGGAGGGTTGGCCTTTGGAAAAGG
Full Trace Sequence: GGCACCATNATAATGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCCAGAACCAGAGCAAGAAGCTAATAAGGAAGAAGAGAAGATACTTTCTGCTGCAGTCCGAGCTAAGATAGAACGCAATAGGCAAAGGGCACTTATGCTGAGACAGGCCAGGCTGGCATGCAGGCCCTATCCCACTGGTGAAGGTATTTCTACAGTTAAAGCACCTCCAAAAGTGATTGATTCAGGAGGAGGATTTTTTATAGAAGAGGAGGAAGCAGAGGAGCAACATGTTGAAAATGTGGTCCGTCAACCTGGACCTGTTCTGGAATGTGATTATCTCATTTGTGAAGAGTGTGGCAAAGATTTTATGGATTCCTACTTAAGCAATCACTTTGACCTAGCAGTCTGCGACAGTTGCAGAGATGCAGAAGAAAAGCACAAACTAATAACGCGTACTGAAGCCAAGCAGGAGTATTTGCTGAAAGACTGCGACGTTGACAAAAGGGAACCAGTTCTAAAATTCATATTAAAGAAAAACCCTCATAACACTCATTGGGGAGACGTGAAACTTTACCTTAAAGCACAGGTAATTAAACGATCACTATAAGTATGGGGCTCTGAGGAAGCTCTTGAAGAAGCAAAGGAGGTACGAAAAGATAACCGAGACCAGATGAAACAAAAGAAATTTGACTAAAAGGTCAAAGAACTGCTTCGTACTGGTGAGGAAAATTTTGTGGAGGAAAGAAGCCAGTGGGCGCCCGCGTGAATAATGGACGGGAGAGGCGGGTAGAGGAAGAAGCGAGAGAAGAAAAAAGCGAAAAACGGGGGCGTTAAAAGTGGGGGGTGGAAAGGGTGTTGGGGAGGTTTGGGGGGGGAGGGTTGGCCTTTGGAAAAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCCAGAACCAGAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838132
dbEST ID: 79655834
Trimmed Sequence: CATTTTTTCATAGTTCATTTCATAGCCACATGTTATGCATGTTTTTTTGTATGAATCTTCCTCTACATGCTCTTCTGGTCCATACTCATGTTGGTGGCCACTGGCTTCTTTTTTCCATAAACTACTCCTCACAGTACGACGCAGTTCTTTGACCTTTTTGTCAAATTTCTTTTGTTTCATCTTGTCTCGGTTATCTTTTCGTACTTCCTTTGCTTCTTCAAGAGCTTCTTCAGAGCCCCATACTTCTAGTGATCGTTTAATTACCTGTGCTTTAAGGTAGAGTTTCATGTCTCCCCAATGAGTGTTATGAGGGTTTTTCTTTAATATGAATTTTAGAACTGGTTCCCTTTTGTCAATGTCGCAGTCTTTCATCAAATACTCCTGCTTGGCTTCGGTACGCATTATTAGTTTGTGCTTTTCTTCTGCATCTCTCCAACTGTCGCAGACTGCTAAGTCAAAGTGATTGGTTAAGTATGAATCCATAAAATCTTTGCCACACTCTTCCCCAATAAAAAAAGCGAATTCCAAAAAGAATCCGGGTTGAGGGAGAAGGTTTTACACATGTTGACTCCCGGCTTCCTCCTCTTCTATCAAAATCCATCTCCTCGATCATCCACTTTTTTAGGTGGTTTGAGAGGGAGAAGAAGCTGTCCCAGTCGGAAAGGGGGTGGGAGGCGGGCCGGGCGCGGTCTGACCGAACGTACCCACTACCGCACATGCCGTTTGTAACTAAAGGGGGGAAGGGGGGGAGGGGGGAGAGGGGTGCGCGTTCCTT
Full Trace Sequence: GGTAATAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATTTTTTCATAGTTCATTTCATAGCCACATGTTATGCATGTTTTTTTGTATGAATCTTCCTCTACATGCTCTTCTGGTCCATACTCATGTTGGTGGCCACTGGCTTCTTTTTTCCATAAACTACTCCTCACAGTACGACGCAGTTCTTTGACCTTTTTGTCAAATTTCTTTTGTTTCATCTTGTCTCGGTTATCTTTTCGTACTTCCTTTGCTTCTTCAAGAGCTTCTTCAGAGCCCCATACTTCTAGTGATCGTTTAATTACCTGTGCTTTAAGGTAGAGTTTCATGTCTCCCCAATGAGTGTTATGAGGGTTTTTCTTTAATATGAATTTTAGAACTGGTTCCCTTTTGTCAATGTCGCAGTCTTTCATCAAATACTCCTGCTTGGCTTCGGTACGCATTATTAGTTTGTGCTTTTCTTCTGCATCTCTCCAACTGTCGCAGACTGCTAAGTCAAAGTGATTGGTTAAGTATGAATCCATAAAATCTTTGCCACACTCTTCCCCAATAAAAAAAGCGAATTCCAAAAAGAATCCGGGTTGAGGGAGAAGGTTTTACACATGTTGACTCCCGGCTTCCTCCTCTTCTATCAAAATCCATCTCCTCGATCATCCACTTTTTTAGGTGGTTTGAGAGGGAGAAGAAGCTGTCCCAGTCGGAAAGGGGGTGGGAGGCGGGCCGGGCGCGGTCTGACCGAACGTACCCACTACCGCACATGCCGTTTGTAACTAAAGGGGGGAAGGGGGGGAGGGGGGAGAGGGGTGCGCGTTCCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATTTTTTCATAGTTCATTTCATA