ORFeome > xrn2 ORF1 – XORFeome v1.0

xrn2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: xrn2
Gene ID: 993161
Gene Page ID: 993156
ORF Xenbase ID: 17305083

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133743
Original XGC clone length: 1374

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ838562
dbEST ID: 79656264
Trimmed Sequence: ATGGGAGTCCCGGCGTTCTTCCGCTGGCTGAGCCGAAAGTATCCATCGATAATCGTACACTGTGTGGAGCAGAAGCCCAAAGAATGTAATAACATTAAAATTCCCGTGGACACCACAAAACCAAATCCAAATGAAGTGGAGTTTGATAACCTTTATTTGGATATGAATGGCATTATCCATCCATGTACTCATCCAGAGGACAAGCCAGCTCCAAAAAATGAAGATGAAATGATGGTTGCTATTTTTGAATACATTGATAGGCTCTTTAACATTGTGAGACCCAGGAGACTTCTTTACATGGCCATTGATGGAGTGGCTCCACGTGCTAAAATGAATCAGCAACGTTCTCGTAGATTTAGAGCATCCAAAGAAGGTGTTGAATCTGTAGAAGAGAAAAATCGTATACGGGAAGAGGTCCTATCCAAAGGTGGGTATCTCCCCAAAGAAGAAATGAGGGAACGATTTGATAGTAACTGCATTACTCCTGGAACAGAGTTTATGGACAACTTGGCAAAATGTCTTCGATATTATATTGCTGACCGTTTAAATAATGATCCTGGTTGGAAAAACCTCACAATAATTTTATCAGACGCTAGTTGTTCTTGGGGAAGGTGAACAGAAAATTATGGAATACATTCAAAAGGCAAAAAACCTCACCCCCATCTTGGACCCAAAACATCCAACCATTGCTTAATGTGGGGGCAAGTGGTGGATCTTATTAATTGTATAGACATTGCCCCTTCCCTGAACCCTAAAATTTTCAATTCTTCCTGTTAAAAGAATTTTAAAGGGGAACACCAACCCTAAACCCTTTATGGGCCTTGGGGGTTGGGCGAGGGGTT
Full Trace Sequence: CGGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAGTCCCGGCGTTCTTCCGCTGGCTGAGCCGAAAGTATCCATCGATAATCGTACACTGTGTGGAGCAGAAGCCCAAAGAATGTAATAACATTAAAATTCCCGTGGACACCACAAAACCAAATCCAAATGAAGTGGAGTTTGATAACCTTTATTTGGATATGAATGGCATTATCCATCCATGTACTCATCCAGAGGACAAGCCAGCTCCAAAAAATGAAGATGAAATGATGGTTGCTATTTTTGAATACATTGATAGGCTCTTTAACATTGTGAGACCCAGGAGACTTCTTTACATGGCCATTGATGGAGTGGCTCCACGTGCTAAAATGAATCAGCAACGTTCTCGTAGATTTAGAGCATCCAAAGAAGGTGTTGAATCTGTAGAAGAGAAAAATCGTATACGGGAAGAGGTCCTATCCAAAGGTGGGTATCTCCCCAAAGAAGAAATGAGGGAACGATTTGATAGTAACTGCATTACTCCTGGAACAGAGTTTATGGACAACTTGGCAAAATGTCTTCGATATTATATTGCTGACCGTTTAAATAATGATCCTGGTTGGAAAAACCTCACAATAATTTTATCAGACGCTAGTTGTTCTTGGGGAAGGTGAACAGAAAATTATGGAATACATTCAAAAGGCAAAAAACCTCACCCCCATCTTGGACCCAAAACATCCAACCATTGCTTAATGTGGGGGCAAGTGGTGGATCTTATTAATTGTATAGACATTGCCCCTTCCCTGAACCCTAAAATTTTCAATTCTTCCTGTTAAAAGAATTTTAAAGGGGAACACCAACCCTAAACCCTTTATGGGCCTTGGGGGTTGGGCGAGGGGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGTCCCGGCGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838561
dbEST ID: 79656263
Trimmed Sequence: CTGATGGAATCGGGCACAGACCGACTTCCATGACCAAGGGCACGAGGGGCAAACTGGCCCGATGTAACGAAAGAAGGTCTTTGATGTTGTGCCTTCATTCTTTTTTTTCCTTTCTTTCTGTCGCCTTTTGAAGTGTTCGTCATCTTCTTTCCTCTTTTTGAAAATGTTGTCTTCAACTTCCCCAACAGCCAACATGATCATTTGCACTCTTTCTAGGTTAACAAATCCACTCTCTGTAAGATAACCCCCAGTTTTATGCACCACATTTTTGTAGATGTTCACAAGACGATCAATTGCGCCTTCCCTGATTTCTAAAGATGGCAGATGTGGTAAAAAATCATTACCCACAAAGAAACACATGAAGACCCAATCATCAACGCTTCTCTCAAAGTCAAACTCGAAGGGCAAGCTGGCCATGGTGAGCTCTTTCTCCAAATACTCTCTTAATATATTGAGACGAATGAGAATGAACTCTTGTTCGCATCCTGGTGGAGCACCAGCAAATTCGTCATGCTCTCCTTTTTTCTCCCTTGGCATTCCCTGACACTCCTTAATCTCATGGCCAAACTGGCCACACAGGCCACAAAGTCTAGGTTTGGTTCGGTTTGAATTCCTCACGGATGATTGTAAAATAAGGTTCATGAATGGCCAGGTCCTAACAAAATAGAATCAGCATCGGCCCCGCATACCCAATAGAATAATGTTTTGGTCCCGGATGGGGGCTGAACCCCTTGCCCCTTTTCAAATTTCACCCCTAAAATTTTTGGTTTTCCCCCTTTCCCCCCCG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGATGGAATCGGGCACAGACCGACTTCCATGACCAAGGGCACGAGGGGCAAACTGGCCCGATGTAACGAAAGAAGGTCTTTGATGTTGTGCCTTCATTCTTTTTTTTCCTTTCTTTCTGTCGCCTTTTGAAGTGTTCGTCATCTTCTTTCCTCTTTTTGAAAATGTTGTCTTCAACTTCCCCAACAGCCAACATGATCATTTGCACTCTTTCTAGGTTAACAAATCCACTCTCTGTAAGATAACCCCCAGTTTTATGCACCACATTTTTGTAGATGTTCACAAGACGATCAATTGCGCCTTCCCTGATTTCTAAAGATGGCAGATGTGGTAAAAAATCATTACCCACAAAGAAACACATGAAGACCCAATCATCAACGCTTCTCTCAAAGTCAAACTCGAAGGGCAAGCTGGCCATGGTGAGCTCTTTCTCCAAATACTCTCTTAATATATTGAGACGAATGAGAATGAACTCTTGTTCGCATCCTGGTGGAGCACCAGCAAATTCGTCATGCTCTCCTTTTTTCTCCCTTGGCATTCCCTGACACTCCTTAATCTCATGGCCAAACTGGCCACACAGGCCACAAAGTCTAGGTTTGGTTCGGTTTGAATTCCTCACGGATGATTGTAAAATAAGGTTCATGAATGGCCAGGTCCTAACAAAATAGAATCAGCATCGGCCCCGCATACCCAATAGAATAATGTTTTGGTCCCGGATGGGGGCTGAACCCCTTGCCCCTTTTCAAATTTCACCCCTAAAATTTTTGGTTTTCCCCCTTTCCCCCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGATGGAATCGGGCAC