ORFeome > xt6l ORF1 – XORFeome v1.0

xt6l ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: xt6l
Gene ID: 6254459
Gene Page ID: 6492154
ORF Xenbase ID: 17305089

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129523
Original XGC clone length: 702

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11093
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ838954
dbEST ID: 79656656
Trimmed Sequence: ATGTTTAAAGGGATATTACTTTGTGTGTTATTTGCTGTGCTCTCTGCAAACCCATTGTCACAGCCAGAAGGCTTTGCAGATGAAGAACGAGATGTCCGAGGACTTGCATCTTTGCTAGGTAAAGCTTTAAAGGCTGGTTTAAAAATTGGTACACATTTTCTGGGAGGAGCACCTCAACAACGGGAAGCCAATGACGAACGTCGCTTTGCTGATGGACAACAAGACTACACAGGTTGGATGGATTTTGGCCGCCGCGACGGAGAAGATGACTACCCAGGTTGCATGGACTTTGGCCGCCTTGATGAAGAGCATTACGTATCTGATTGTAGAAACGAACAGGTCGCTCTCTTTCATAATAAAATCATTATTGCTGCTCCTAACAGATGGTGCCTATGCGCAGGGAGAGAACATCTGACAAACAAGTATCCTGTGACGACTGTCGCAAAACCGAAGTACCCAATACTACACAGGTTGGATGGATTTTGGAAAACGCAATGGTGAAGATGATTTGAAAAAAGCCTTAGAAC
Full Trace Sequence: CTACGGGACCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTAAAGGGATATTACTTTGTGTGTTATTTGCTGTGCTCTCTGCAAACCCATTGTCACAGCCAGAAGGCTTTGCAGATGAAGAACGAGATGTCCGAGGACTTGCATCTTTGCTAGGTAAAGCTTTAAAGGCTGGTTTAAAAATTGGTACACATTTTCTGGGAGGAGCACCTCAACAACGGGAAGCCAATGACGAACGTCGCTTTGCTGATGGACAACAAGACTACACAGGTTGGATGGATTTTGGCCGCCGCGACGGAGAAGATGACTACCCAGGTTGCATGGACTTTGGCCGCCTTGATGAAGAGCATTACGTATCTGATTGTAGAAACGAACAGGTCGCTCTCTTTCATAATAAAATCATTATTGCTGCTCCTAACAGATGGTGCCTATGCGCAGGGAGAGAACATCTGACAAACAAGTATCCTGTGACGACTGTCGCAAAACCGAAGTACCCAATACTACACAGGTTGGATGGATTTTGGAAAACGCAATGGTGAAGATGATTTGAAAAAAGCCTTAGAACAAGGTTGCCATAAAATAAAGCATTGCTTATCAATTTGATGCAACGAACAGAGTACTATCAGTCAAAATAAATCATTATTTGCCATCCAGCTGATATCCCCCAAAGTGACTGCATATTAAATGGTCATAAGCGGAAAACAGGAAACTCTAGGCCGCTGTCCCCAGAACCTCTGAAAGTTAAAAAAAAAAAAAAAAAAACCTTTATACGGTCCAAACAGAAAAGAAAGAAATATCCAGCCGTAAAGAACAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAANAGAAGGAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTAAAGGGATATTACTTTG

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGCAACAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTNACCTGTTCNTTNCNNCNNATTNATAANCAATGCTTTCTTATAATGCCAACTTTNTACAAAAAANTTNNCAAATCATCTTCACCATTNCNNNCNNCCAAAATCCATCCAACCTNTNTANTCTTNTTNTCCATCANCAAANCAACNTTCNTCATTANCTTCCCNTTATTAAANTCCTCCTCCCAAAAAATTTNTACCAATTTTTAAACCACCCTTTAAAACTTTACCTATCAAAAATCCAAATCCTCCAACATCTCATTCTTCATCATCATATCCTTCTTCCTATCACCATAAATCTACCCAAACCACATCAACTAACACACAATCTAATATCCCTTTATACATCCTACCTACTTTTTTATACATACTTCCCATTATAAAAAAATATTCCTCATCAATTTCTTTCATCAAACACTTCACTATCAATCAAAATACAATCATTATTTCCACCCCTAACTAAATAACCAAACAACAAAACAAAACCTCTTAAACTCACANTCTTCAATAACCAAAAACAAAAAACTAACACAATCAATTTTTCAAAAAACACNCCAACTTACCCACCAACTAATAAATAATATTAACACAATTCCAACTAATTTNTAACAAATTNACACAAAAAAAANCCATACTCATTTTATAAATTCCAACCAAAATTTCATAACACATCAAAATAACACATTAATTANCAACTCCAAAACAAAAAACNTAAAACTCNTTTTAAAAANANNNNNAATANNNNNNNNANNANNNNTANANNATANNNNNNNNNAAANNNNNNAAAAANNNANNAAAANAANNNNNAAAAAAAAAAAANNANNNNNNANNNNNNNNNNNNNNNNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCATCTTCACCATTGCGG