ORFeome > yap1 ORF1 – XORFeome v1.0

yap1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: yap1
Gene ID: 952397
Gene Page ID: 952393
ORF Xenbase ID: 17305125

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108591
Original XGC clone length: 1008

Human orthology & disease relationships

NCBI Entrez ID: 10413
Ensembl gene IDs: ENSG00000137693
Directly associated (OMIM) disease MIM numbers: 120433
Indirectly associated (Lage, et al.) disease MIM numbers: 119600,133239,136680,137357,151623,194070,194080,211980,256370,260500,275355,600195,601399

Library Location

Plate ID: GDExl11087
Well Location: C04

Sequences - 5สน (forward) EST

Accession: JZ838006
dbEST ID: 79655708
Trimmed Sequence: ATGGAGCCCGGCTCCCAGCAACAACCTTCCGCCCCGGGTCAGCAGCCTCCCCCTGTGGGACACCAGATCGTGCATGTGCGGACCGACTCGGAGACCGACTTGGAGACTCTGTTTAACGCCGTCATGAACCCGAAGAATGCGAATGTGCCCCAGACTCTGCCCATGCGCATGAGGAAACTCCCGGACTCGTTCTTCAAGCAGCCCGAGCCCAAGTCCCACTCACGTCACGTTGACCAAACGACGACATGGCAGGATCCAAGGAAGGCCATGCTCTCTCAGATAAACATTACTGCTCCAACAAGCCCGCCCGTGCAGCAGAACATAATGACCCCAACAGCTATGAATCAACAGAGGTTAAGCCAGAGCGCTCCTGTCAAATCCCCACCTGCCTTACAGCCCCAGAGCCCTCCGAGTGGGGTGCTGGGCAGTGGAGGTAACCAACAAATGCGCCTCCAGCAGCTTCAGATGGAGAAAGAACGGCTCCGGCTAAAGCATCAAGAACTGCTTCGGCAGGTGAGGCCACAGGAACTTGCTCTCCGCAGTCAGATCCCACCAATGGAGCAGGACAGTGGCCCTCCGAATCCAGTGTGTTCATCAGGGATTTCCCAGGAGCTGAGAACAATGACGATGAACAGCTCAGATCCATTCCTCAACAGTGGAACGTATCACTCCGGAAACAAAAGCACTGACCGCGGAATAAACATGAGCAATTACCGTGGTTCCAGGAACTCCTGAAGATTTCCTTAAAAATTGTTAATAAAAATGGGACCCGGGTGAAAGCTATTAACCCCAAATTATAAATTCCCAACCCCAACAAAA
Full Trace Sequence: TCGTGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCCCGGCTCCCAGCAACAACCTTCCGCCCCGGGTCAGCAGCCTCCCCCTGTGGGACACCAGATCGTGCATGTGCGGACCGACTCGGAGACCGACTTGGAGACTCTGTTTAACGCCGTCATGAACCCGAAGAATGCGAATGTGCCCCAGACTCTGCCCATGCGCATGAGGAAACTCCCGGACTCGTTCTTCAAGCAGCCCGAGCCCAAGTCCCACTCACGTCACGTTGACCAAACGACGACATGGCAGGATCCAAGGAAGGCCATGCTCTCTCAGATAAACATTACTGCTCCAACAAGCCCGCCCGTGCAGCAGAACATAATGACCCCAACAGCTATGAATCAACAGAGGTTAAGCCAGAGCGCTCCTGTCAAATCCCCACCTGCCTTACAGCCCCAGAGCCCTCCGAGTGGGGTGCTGGGCAGTGGAGGTAACCAACAAATGCGCCTCCAGCAGCTTCAGATGGAGAAAGAACGGCTCCGGCTAAAGCATCAAGAACTGCTTCGGCAGGTGAGGCCACAGGAACTTGCTCTCCGCAGTCAGATCCCACCAATGGAGCAGGACAGTGGCCCTCCGAATCCAGTGTGTTCATCAGGGATTTCCCAGGAGCTGAGAACAATGACGATGAACAGCTCAGATCCATTCCTCAACAGTGGAACGTATCACTCCGGAAACAAAAGCACTGACCGCGGAATAAACATGAGCAATTACCGTGGTTCCAGGAACTCCTGAAGATTTCCTTAAAAATTGTTAATAAAAATGGGACCCGGGTGAAAGCTATTAACCCCAAATTATAAATTCCCAACCCCAACAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCCCGGCTCCCAG

Sequences - 3สน (reverse) EST

Accession: JZ838005
dbEST ID: 79655707
Trimmed Sequence: TAACCACGTGAGAAAGCTTTCCTTATCTAGTTTGGTTGCTGCCAGAACGGTCTCCATGTCGTTAAGGATATCAGAACTGAGGGCTTCTTGAAGGCTCGGCATAAGTTCTTCCCCTTCCACATTCATTGCTTCTCCCTCTAGTGTGCCAAGGTCCACATTTGTGCCTGGAAGGGTTTCCAAATAGTCTGGGAACCGGTTCTGTTGGGTAGGAATTGTACTTTGGGTAATAGCTTCACCTGTGTCCATTTCATCAACACTATTAAGGAAATCATCAGGAGTCCTGGGAACACTGTAACTGCTCATGCTTAATCCGCTGTCAGTGCTTTCGTCTCTGGAGTGATACGTTCCACTGTTGAGGAATGGATCTGAGCTGTTCATCGTCATTGTTCTCAGCTCCTGGGAAATCCCTGATGAACACACTGGATTCGGAGGGCCACTGTCCTGCTCCATTGGTGGGATCTGACTGCGGAGAGCAAGTTCCTGTGGCCTCACCTGCCGAAACAGTTCTTGATGCTTTAGCCGGAGCCGTTCTCTCTCCTTCTGAAGCTGCTGGAGGGGCATTGGTTGGTTACCTCCGCCTGCCAGCACCGCCCTCGAACGGCTCCGGGGGTGTGGGGAGGTGGGGGGATTTGGAGGAGCCCTCCTGGCTTAACCTCTGCTGATTCCTAGCCGGTGGGGGTCAGGAATTTTGGGGCTTCACTGGGGGGGGGTGGGTTGGGAGGGAGGAGTTTTTTACGCTAAAAAGAAACCGGGGACCATTCCCTTGGAAACCC
Full Trace Sequence: AAAATGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAACCACGTGAGAAAGCTTTCCTTATCTAGTTTGGTTGCTGCCAGAACGGTCTCCATGTCGTTAAGGATATCAGAACTGAGGGCTTCTTGAAGGCTCGGCATAAGTTCTTCCCCTTCCACATTCATTGCTTCTCCCTCTAGTGTGCCAAGGTCCACATTTGTGCCTGGAAGGGTTTCCAAATAGTCTGGGAACCGGTTCTGTTGGGTAGGAATTGTACTTTGGGTAATAGCTTCACCTGTGTCCATTTCATCAACACTATTAAGGAAATCATCAGGAGTCCTGGGAACACTGTAACTGCTCATGCTTAATCCGCTGTCAGTGCTTTCGTCTCTGGAGTGATACGTTCCACTGTTGAGGAATGGATCTGAGCTGTTCATCGTCATTGTTCTCAGCTCCTGGGAAATCCCTGATGAACACACTGGATTCGGAGGGCCACTGTCCTGCTCCATTGGTGGGATCTGACTGCGGAGAGCAAGTTCCTGTGGCCTCACCTGCCGAAACAGTTCTTGATGCTTTAGCCGGAGCCGTTCTCTCTCCTTCTGAAGCTGCTGGAGGGGCATTGGTTGGTTACCTCCGCCTGCCAGCACCGCCCTCGAACGGCTCCGGGGGTGTGGGGAGGTGGGGGGATTTGGAGGAGCCCTCCTGGCTTAACCTCTGCTGATTCCTAGCCGGTGGGGGTCAGGAATTTTGGGGCTTCACTGGGGGGGGGTGGGTTGGGAGGGAGGAGTTTTTTACGCTAAAAAGAAACCGGGGACCATTCCCTTGGAAACCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAACCACGTGAGAAAGCTTTCC