ORFeome > yif1b ORF1 – XORFeome v1.0

yif1b ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: yif1b
Gene ID: 922895
Gene Page ID: 922880
ORF Xenbase ID: 17305179

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099271
Original XGC clone length: 903

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: JZ840106
dbEST ID: 79657808
Trimmed Sequence: ATGAACCAGGAGAGCAGCTTCAGAGCCCCCCCCAAGAGACGCGTTCGGGGCTCCAACCCAAACATATCGAACCCCCACCAGCTGTTTGATGACACAAGTGGAGGGCCTGTTCCTCATGGAGGAGACTTTCCCAACCATTCATCCCCAGCTTTGGGTATCCCGGCACAAGCCTTTTTGTCAGAACCCATGTCCAACTTTGCTATGGCCTATGGCAGCAGCTTGGCCAGCCAGGGAAAGGAGATGATGGACAAGAATATCGACCGGATTATCCCAGTCAGCAAAATCAAATATTATTTTGCGGTTGACACAGTCTATGTGGGTAAAAAGATTGGGCTGCTTATGTTTCCCTACATGCATCAGGATTGGGAAGTGAGATACCAACAGGACACCCCCGTGGCCCCACGATTTGACATAAATGCTCCTGATCTTTACATTCCAGTCATGGCTTTTATCACATATATTCTGGTGGCTGGCTTGGCACTGGGGACACAGAGCAGATTTTCACCTGAGATCCTGGGAATGCAGGCTAGTTCGGCCCTTGCTTGGCTTATTGTAGAGGTACTTGCCATCCTCCTCAGCCTTTACCTAGTGACAGTAAATACAGATCTTACCACAGTGGATCTTGTTGCTTTTTCCGGATATAAATATGTTGGGGATGATTTCAGGAGTTATTGCTGGGCCTTCTCCTTGGGAACCACTGGTTACTATGTAGTGGTCCGCTTGGTGCTGTATTCTCTAGATTTTTTTTCG
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACCAGGAGAGCAGCTTCAGAGCCCCCCCCAAGAGACGCGTTCGGGGCTCCAACCCAAACATATCGAACCCCCACCAGCTGTTTGATGACACAAGTGGAGGGCCTGTTCCTCATGGAGGAGACTTTCCCAACCATTCATCCCCAGCTTTGGGTATCCCGGCACAAGCCTTTTTGTCAGAACCCATGTCCAACTTTGCTATGGCCTATGGCAGCAGCTTGGCCAGCCAGGGAAAGGAGATGATGGACAAGAATATCGACCGGATTATCCCAGTCAGCAAAATCAAATATTATTTTGCGGTTGACACAGTCTATGTGGGTAAAAAGATTGGGCTGCTTATGTTTCCCTACATGCATCAGGATTGGGAAGTGAGATACCAACAGGACACCCCCGTGGCCCCACGATTTGACATAAATGCTCCTGATCTTTACATTCCAGTCATGGCTTTTATCACATATATTCTGGTGGCTGGCTTGGCACTGGGGACACAGAGCAGATTTTCACCTGAGATCCTGGGAATGCAGGCTAGTTCGGCCCTTGCTTGGCTTATTGTAGAGGTACTTGCCATCCTCCTCAGCCTTTACCTAGTGACAGTAAATACAGATCTTACCACAGTGGATCTTGTTGCTTTTTCCGGATATAAATATGTTGGGGATGATTTCAGGAGTTATTGCTGGGCCTTCTCCTTGGGAACCACTGGTTACTATGTAGTGGTCCGCTTGGTGCTGTATTCTCTAGATTTTTTTTCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACCAGGAGAGCAGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ840105
dbEST ID: 79657807
Trimmed Sequence: TCTCACCAGGTGGTAGGTCAGCCAGTACATGAAGATGGGCTGCACAGCAGCAATAGCCATTGTAAGGTACATACGCAGCTGGTTCCTGGCTCCACGAACCAAAACACCTTCAGCTGCAGCCTCAGAGAGAATCTTCAAACGAAGGGTGCGGATCATGAAAAAAACTATAGAGATACAGCACCAAGCGAGCACTACATAGTAACCAGTGTTCCCAAAGAGAAGGCCAGCAATAACTCCTGAAATCATCCCCACATATTTATATCCGGAAAAAGCAACAAGATCCACTGTGGTAAGATCTGTATTTACTGTCACTAGGTAAAGGCTGAGGAGGATGGCAAGTACCTCTACAATAAGCCAAGCAAGGGCCGAACTAGCCTGCATTCCCAGGATCTCAGGTGAAAATCTGCTCTGTGTCCCCAGTGCCAAGCCAGCCACCAGAATATATGTGATAAAAGCCATGACTGGAATGTAAAGATCAGGAGCATTTATGTCAAATCGTGGGGCCACGGGGGTGTCCTGTTGGTATCTCACTTCCCAATCCTGATGCATGTAGGGAAACATAAGCAGCCCAATCTTTTTACCCACATAGACTGTGTCAACCGCAAAATAATATTTGATTTTGCTGACTGGGAATAATCCGGGTCGATATTCCTTGTCCTTCATCCTCCTTTTCCCTGGCCTGGGCCCAGCTGCCTCCCAAAAGGCCCATAAGCAAAAGTTGGGAA
Full Trace Sequence: GGACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTCACCAGGTGGTAGGTCAGCCAGTACATGAAGATGGGCTGCACAGCAGCAATAGCCATTGTAAGGTACATACGCAGCTGGTTCCTGGCTCCACGAACCAAAACACCTTCAGCTGCAGCCTCAGAGAGAATCTTCAAACGAAGGGTGCGGATCATGAAAAAAACTATAGAGATACAGCACCAAGCGAGCACTACATAGTAACCAGTGTTCCCAAAGAGAAGGCCAGCAATAACTCCTGAAATCATCCCCACATATTTATATCCGGAAAAAGCAACAAGATCCACTGTGGTAAGATCTGTATTTACTGTCACTAGGTAAAGGCTGAGGAGGATGGCAAGTACCTCTACAATAAGCCAAGCAAGGGCCGAACTAGCCTGCATTCCCAGGATCTCAGGTGAAAATCTGCTCTGTGTCCCCAGTGCCAAGCCAGCCACCAGAATATATGTGATAAAAGCCATGACTGGAATGTAAAGATCAGGAGCATTTATGTCAAATCGTGGGGCCACGGGGGTGTCCTGTTGGTATCTCACTTCCCAATCCTGATGCATGTAGGGAAACATAAGCAGCCCAATCTTTTTACCCACATAGACTGTGTCAACCGCAAAATAATATTTGATTTTGCTGACTGGGAATAATCCGGGTCGATATTCCTTGTCCTTCATCCTCCTTTTCCCTGGCCTGGGCCCAGCTGCCTCCCAAAAGGCCCATAAGCAAAAGTTGGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTCACCAGGTGGTAGGTC