ORFeome > yipf5 ORF1 – XORFeome v1.0

yipf5 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: yipf5
Gene ID: 977468
Gene Page ID: 977460
ORF Xenbase ID: 17305215

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC055267
Original XGC clone length: 771

Human orthology & disease relationships

NCBI Entrez ID: 81555
Ensembl gene IDs: ENSG00000145817
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ839343
dbEST ID: 79657045
Trimmed Sequence: ATGTCGAACTTCGATAATTTCAACACAGATTTCTATCAGACCAGCTATAGTATAGATGATCAGTCTCAGGGCTACAACTACAATGCAGGCGGAGCGCAATACAGCAAGCAATATCCTTATGATCCCTACAGTCAACAAGGAGGTTTTATTCTACAAGAGATGAATCAACAACAACAGCCATATACAGGACAGATATACCAGCCTACACAAACATACACTCCCACAGCGACTGAATCTGTGTATGGAAGTACATTTGATGATGAGCCACCTCTGCTGGAAGAACTTGGAATCAACTTTGACCACATTTGGCAGAAAACTCTGACTGTGCTACACCCTTTAAAAGTAGCAGATGGCAGCATTATGAATGAGACGGATTTGGCGGGTCCAATGGTCTTTTGTCTAGCATTTGGAGCTACATTATTGTTGGCTGGAAAGATACAATTTGGCTATGTCTATGGAATTAGTGCAATGGGTTGTCTGGGAATGTACTGTCTGCTGAATTTAATGAGCATGACCGGTGTGTCGTTTGGCTGTGTATCCAGTGTACTCGGTTACTGTCTCCTTCCCATGATCATACTCTCTACTTTTGCTGTCATTTTCTCTTTACAAGGAATTTTGGGCATCGTTCTCGCTGCCTTAATAATTGGCTGGTGCCGTTTCTCCGGCCTCAAAGATCTTCATTTCTGCCTTTGGCTGGGATGGAGCGCAACCTTCAGTTGGCTACCCCTGGGCTTTTATTTTATGGAATCTTTTGCTCTTATCCTTTTGTTTTTGGCCAACCTTTTCCTGGGACAAGGTTGGGGCCTTTAAAAAA
Full Trace Sequence: TCGGGGCCCCAATAANTGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGAACTTCGATAATTTCAACACAGATTTCTATCAGACCAGCTATAGTATAGATGATCAGTCTCAGGGCTACAACTACAATGCAGGCGGAGCGCAATACAGCAAGCAATATCCTTATGATCCCTACAGTCAACAAGGAGGTTTTATTCTACAAGAGATGAATCAACAACAACAGCCATATACAGGACAGATATACCAGCCTACACAAACATACACTCCCACAGCGACTGAATCTGTGTATGGAAGTACATTTGATGATGAGCCACCTCTGCTGGAAGAACTTGGAATCAACTTTGACCACATTTGGCAGAAAACTCTGACTGTGCTACACCCTTTAAAAGTAGCAGATGGCAGCATTATGAATGAGACGGATTTGGCGGGTCCAATGGTCTTTTGTCTAGCATTTGGAGCTACATTATTGTTGGCTGGAAAGATACAATTTGGCTATGTCTATGGAATTAGTGCAATGGGTTGTCTGGGAATGTACTGTCTGCTGAATTTAATGAGCATGACCGGTGTGTCGTTTGGCTGTGTATCCAGTGTACTCGGTTACTGTCTCCTTCCCATGATCATACTCTCTACTTTTGCTGTCATTTTCTCTTTACAAGGAATTTTGGGCATCGTTCTCGCTGCCTTAATAATTGGCTGGTGCCGTTTCTCCGGCCTCAAAGATCTTCATTTCTGCCTTTGGCTGGGATGGAGCGCAACCTTCAGTTGGCTACCCCTGGGCTTTTATTTTATGGAATCTTTTGCTCTTATCCTTTTGTTTTTGGCCAACCTTTTCCTGGGACAAGGTTGGGGCCTTTAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGAACTTCGATAATTTCAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839342
dbEST ID: 79657044
Trimmed Sequence: AAACACAGAGATAAGAGCAAAGACTCCATAAAGTAAAGCGCAAGGGTAGGCAACTAGAAGTTGCTGTCCATCCATGGCCAAAGCAGAAATGAAGATCTTTGAGGCGGAGAAACTGCACCAGCCAATTATTAAGGCAGCGAGAACGATGCCCAAAATTCCTTGTAAAGAGAAAATGACAGCAAAAGTAGAGAGTATGATCATGGGAAGGAGACAGTAACCGAGTACACTGGATACACAGCCAAACGACACACCGGTCATGCTCATTAAATTCAGCAGACAGTACATTCCCAGACAACCCATTGCACTAATTCCATAGACATAGCCAAATTGTATCTTTCCAGCCAACAATAATGTAGCTCCAAATGCTAGACAAAAGACCATTGGACCCGCCAAATCCGTCTCATTCATAATGCTGCCATCTGCTACTTTTAAAGGGTGTAGCACAGTCAGAGTTTTCTGCCAAATGTGGTCAAAGTTGAATTCCAGTTCTTCCAGCAGAGGTGGCTCATCATCAAATGTACTTCCATACACAGATTCAGTCGCTGTGGGAGTGTATGTTTGTGTAGGCTGGTATATCTGTCCTGTATATGGCTGTTGGTTGTTGATTCATCCTCTGGAGAAAAAAACCTCCCTTGTGACTGTAGGGATCAAAAGGAAATTGCTTGGTGTATTGGGCTCCCCCCCGGCATTGGAAGTTTTAGCCCCGGAAAACCTGATCAACTCTAAACAAAAAAACGGGGGTCCGGAAAAAAAA
Full Trace Sequence: CGGGTAAACNGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAACACAGAGATAAGAGCAAAGACTCCATAAAGTAAAGCGCAAGGGTAGGCAACTAGAAGTTGCTGTCCATCCATGGCCAAAGCAGAAATGAAGATCTTTGAGGCGGAGAAACTGCACCAGCCAATTATTAAGGCAGCGAGAACGATGCCCAAAATTCCTTGTAAAGAGAAAATGACAGCAAAAGTAGAGAGTATGATCATGGGAAGGAGACAGTAACCGAGTACACTGGATACACAGCCAAACGACACACCGGTCATGCTCATTAAATTCAGCAGACAGTACATTCCCAGACAACCCATTGCACTAATTCCATAGACATAGCCAAATTGTATCTTTCCAGCCAACAATAATGTAGCTCCAAATGCTAGACAAAAGACCATTGGACCCGCCAAATCCGTCTCATTCATAATGCTGCCATCTGCTACTTTTAAAGGGTGTAGCACAGTCAGAGTTTTCTGCCAAATGTGGTCAAAGTTGAATTCCAGTTCTTCCAGCAGAGGTGGCTCATCATCAAATGTACTTCCATACACAGATTCAGTCGCTGTGGGAGTGTATGTTTGTGTAGGCTGGTATATCTGTCCTGTATATGGCTGTTGGTTGTTGATTCATCCTCTGGAGAAAAAAACCTCCCTTGTGACTGTAGGGATCAAAAGGAAATTGCTTGGTGTATTGGGCTCCCCCCCGGCATTGGAAGTTTTAGCCCCGGAAAACCTGATCAACTCTAAACAAAAAAACGGGGGTCCGGAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAACACAGAGATAAGAGCAAAGAC