ORFeome > yipf6 ORF1 – XORFeome v1.0

yipf6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: yipf6
Gene ID: 6078679
Gene Page ID: 1009735
ORF Xenbase ID: 17305221

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133181
Original XGC clone length: 699

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ838652
dbEST ID: 79656354
Trimmed Sequence: ATGGCGGAAACAGAGGGAATTGGAGACGGCAGTAAGCAGCTGTTTGCAGGATTATCAAATGTATCGATATCAGGAGATATTCCGGTTGAGGGGGAGATCACTGTCCCCATGGCCTCAACCTCACAAGAGGATGACTTTTCCACACTGGATGAGCCGGTTAAAGACACCATAATGCGGGACCTGAAGGCTGTCGGCAATAAGTTTGTTCATGTTATGTATCCTAAAAAGAGCACATCACTTCTTAGAGATTGGGATTTGTGGGGTCCTCTGGTGCTGTGTGTTTCACTTGCCTTAATGCTGCAGGGCGGCAATGCTGATAGCAAAGATGACGGAGGACCTCAGTTTGCTGAAGTTTTTGTCATCATCTGGTTTGGGGCTATAATTATCACTCTGAACTCCAAGTTGCTTGGTGGTACCATTTCCTTCTTCCAAAGTCTGTGTGTGCTGGGTTATTGCATCGTACCCTTGACCGTGGCTATGGTGGGGTGTAGGCTGATGCTTCTAGTTGAGTAACAGGACCGCAGGTATCATCGTCCGACTAGTTAGAGTGAACAGTCAAGGTTTCCTGGGCCCACTTTTTTGATCCGCTGCCGTGAGAGCGAACGTCAGACACCAAATGCGGAGGGAACTGGCGGGGTGGTCGGTGTTCGTCTTGCTGTTTTTGGCAACAGCTGGAAGGTTGTGGCCCTGTAACGGCGTAGAACTTGGCCAATGTTCGTTGACAAAAATGGGAATGAGGAAGTAAAGGGAGGGAATTAGGGATTTTTTTTGGAAGGGAGAGGGAG
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAAACAGAGGGAATTGGAGACGGCAGTAAGCAGCTGTTTGCAGGATTATCAAATGTATCGATATCAGGAGATATTCCGGTTGAGGGGGAGATCACTGTCCCCATGGCCTCAACCTCACAAGAGGATGACTTTTCCACACTGGATGAGCCGGTTAAAGACACCATAATGCGGGACCTGAAGGCTGTCGGCAATAAGTTTGTTCATGTTATGTATCCTAAAAAGAGCACATCACTTCTTAGAGATTGGGATTTGTGGGGTCCTCTGGTGCTGTGTGTTTCACTTGCCTTAATGCTGCAGGGCGGCAATGCTGATAGCAAAGATGACGGAGGACCTCAGTTTGCTGAAGTTTTTGTCATCATCTGGTTTGGGGCTATAATTATCACTCTGAACTCCAAGTTGCTTGGTGGTACCATTTCCTTCTTCCAAAGTCTGTGTGTGCTGGGTTATTGCATCGTACCCTTGACCGTGGCTATGGTGGGGTGTAGGCTGATGCTTCTAGTTGAGTAACAGGACCGCAGGTATCATCGTCCGACTAGTTAGAGTGAACAGTCAAGGTTTCCTGGGCCCACTTTTTTGATCCGCTGCCGTGAGAGCGAACGTCAGACACCAAATGCGGAGGGAACTGGCGGGGTGGTCGGTGTTCGTCTTGCTGTTTTTGGCAACAGCTGGAAGGTTGTGGCCCTGTAACGGCGTAGAACTTGGCCAATGTTCGTTGACAAAAATGGGAATGAGGAAGTAAAGGGAGGGAATTAGGGATTTTTTTTGGAAGGGAGAGGGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAAACAGAGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838651
dbEST ID: 79656353
Trimmed Sequence: GCTCACGGTGTTAAAGGTCAAGACCATCCAGCTGATGACAAAATAGAAGAGGAATATGGGATAGACCGCCAGAGCTCTACGATTTGGTGGCTGACTGTCAGCTAAGAAGGCAGTGGAGGCAAAAGTGGACCAGGCAAACATGACTGTCACTACAACTAGTCGGACGATGAAACTTGCGGTCTTGTTACTCAACAGAAGCATCAGCCTACACACCACCATAGCCACGGTCAAGGGTAAGATGCAATAACCCAGCACACACAGACTTTGGAAGAAGGAAATGGTACCACCAAGCAACTTGGAGTTTAGAGTGATAATTATAGCCCCAAACCAGATGATGACAAAAACTTCAGCAAACTGAGGTCCTCCGTCATCTTTGCTATCAGCATTGCCGCCCTGCAGCATTAAGGCAAGTGAAACACACAGCACCAGAGGACCCCACAAATCCCAATCTCTAAGAAGTGATGTGCTCTTTTTAGGATACGTAACATGAACAAACTTATTGCCGACAGCCTTCCGGTCCCCCATTATGGTGTCTTTAACCCGCTCATCCGGTGTGGAGGAGTCCTCCTCTTGTGAGGGTGAGGCGTGGGGACAGGGATCTCCGCCTCCCCCCGGATAATCTCCTGAATCGGATACGTTGATAAATCCTGCAAACACCTGCCTACTGCCCGTCTCCGTTTCCTTCTGTTTTCCGCCTGGGTTGGCACCGTGTTTGGGTCCAATTTTTGCTCATTATAAAAAGAGGCAGTGCCCCCCCCCC
Full Trace Sequence: AAAAGGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTCACGGTGTTAAAGGTCAAGACCATCCAGCTGATGACAAAATAGAAGAGGAATATGGGATAGACCGCCAGAGCTCTACGATTTGGTGGCTGACTGTCAGCTAAGAAGGCAGTGGAGGCAAAAGTGGACCAGGCAAACATGACTGTCACTACAACTAGTCGGACGATGAAACTTGCGGTCTTGTTACTCAACAGAAGCATCAGCCTACACACCACCATAGCCACGGTCAAGGGTAAGATGCAATAACCCAGCACACACAGACTTTGGAAGAAGGAAATGGTACCACCAAGCAACTTGGAGTTTAGAGTGATAATTATAGCCCCAAACCAGATGATGACAAAAACTTCAGCAAACTGAGGTCCTCCGTCATCTTTGCTATCAGCATTGCCGCCCTGCAGCATTAAGGCAAGTGAAACACACAGCACCAGAGGACCCCACAAATCCCAATCTCTAAGAAGTGATGTGCTCTTTTTAGGATACGTAACATGAACAAACTTATTGCCGACAGCCTTCCGGTCCCCCATTATGGTGTCTTTAACCCGCTCATCCGGTGTGGAGGAGTCCTCCTCTTGTGAGGGTGAGGCGTGGGGACAGGGATCTCCGCCTCCCCCCGGATAATCTCCTGAATCGGATACGTTGATAAATCCTGCAAACACCTGCCTACTGCCCGTCTCCGTTTCCTTCTGTTTTCCGCCTGGGTTGGCACCGTGTTTGGGTCCAATTTTTGCTCATTATAAAAAGAGGCAGTGCCCCCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTCACGGTGTTAAAGGTC