ORFeome > yod1 ORF1 – XORFeome v1.0

yod1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: yod1
Gene ID: 998963
Gene Page ID: 998959
ORF Xenbase ID: 17305245

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123321
Original XGC clone length: 915

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ837477
dbEST ID: 79655179
Trimmed Sequence: ATGTTGCGGCTCAGATGTAAAACCCGAGAGGGCACTCAACTTCTTCAAGGCCTCACAGACCGCTCCAGTATTCGGGAGTTGCAAGAGCGTATTGCTGGTGTTACTGGTATTTCAGGGCCACTGCAGCGCGTAATGGTGGGGTTTCCCCCTCTATCCCTGGACTTAAGCGACGAAGAGGCCACATTAAAGAACATGTCCATCAAATCCGGAGACACGCTTATTGTGGAAGAAGATAAAAGTAAGCTGAGGTCAGCAACTCCTCCCGTTTCCAAAACAGACATCGGTAATTGGAATGCACCAGCACAGCCAACAATTGTCCGGAGGGTAGTTCCAGCAGATAACTCATGTTTGTTCACAAGCATTTACTATGTGGTAGAAGGGGGTGTTTATGACCCAGCATGCGCCCTAGAAATGCGCAGCCTTATTGCAGAGATTGTGGCCAGTGACCAGTCTGCTTACTGTGACGCTGTTCTTGGTAAAAGTAATGAGGAATATTGCTCATGGATTAGAAAAGAAGACACATGGGGAGGTGCTATTGAAGTTTCCATTCTCTCCGAGTTCTACCAGTGTGAAATTTGTGTGGTAGACACTCACACTGTACGGATAGATAAATTTGGGGAACATTCTGGTTATGGCCGACGTGTTTTACTAATTTATGATGGGAGACGGGGGGATCCATTAAAAACTTCATTTTTCCAAATCCTAACATTCCCTGCGGGGAAGGGTCTTTTTTCGCCTCTCTATTATTGAAACCCTCTTGTTCCCGCGCTTTTGGAGGGTGTGGGAGATGAAAGGCTTGGAGAGGAAAGGAAAGGGG
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGCGGCTCAGATGTAAAACCCGAGAGGGCACTCAACTTCTTCAAGGCCTCACAGACCGCTCCAGTATTCGGGAGTTGCAAGAGCGTATTGCTGGTGTTACTGGTATTTCAGGGCCACTGCAGCGCGTAATGGTGGGGTTTCCCCCTCTATCCCTGGACTTAAGCGACGAAGAGGCCACATTAAAGAACATGTCCATCAAATCCGGAGACACGCTTATTGTGGAAGAAGATAAAAGTAAGCTGAGGTCAGCAACTCCTCCCGTTTCCAAAACAGACATCGGTAATTGGAATGCACCAGCACAGCCAACAATTGTCCGGAGGGTAGTTCCAGCAGATAACTCATGTTTGTTCACAAGCATTTACTATGTGGTAGAAGGGGGTGTTTATGACCCAGCATGCGCCCTAGAAATGCGCAGCCTTATTGCAGAGATTGTGGCCAGTGACCAGTCTGCTTACTGTGACGCTGTTCTTGGTAAAAGTAATGAGGAATATTGCTCATGGATTAGAAAAGAAGACACATGGGGAGGTGCTATTGAAGTTTCCATTCTCTCCGAGTTCTACCAGTGTGAAATTTGTGTGGTAGACACTCACACTGTACGGATAGATAAATTTGGGGAACATTCTGGTTATGGCCGACGTGTTTTACTAATTTATGATGGGAGACGGGGGGATCCATTAAAAACTTCATTTTTCCAAATCCTAACATTCCCTGCGGGGAAGGGTCTTTTTTCGCCTCTCTATTATTGAAACCCTCTTGTTCCCGCGCTTTTGGAGGGTGTGGGAGATGAAAGGCTTGGAGAGGAAAGGAAAGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGCGGCTCAGATGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837476
dbEST ID: 79655178
Trimmed Sequence: CACCTCACCAAAATTGGTATGCCCGGTCTCCTTGGCATGATCCCTTGCAGCTGACTGCCCAGTCAACCCTTTCTGACACGCCATGCAACGCAGAGCAAATTGGTTTACATCTGTAAACTGCCTCTTCTTCCTAGCATCATCTGCAAGCTCCATAGCCTGTACAAGAGCTTCATCATCTGTTGTGGAAAAGACGGTCATTGGAGGCATGTCAGGATCTGGAAACTGACGTTGTAATGGATCATAGTGTATACCATCATAAATTAGTAAAACACGTTTGGTATAACCAGAATCTTCCCCAAATCTATCTATCCGTACAGTCTGAGTGTCTACCACACAAATTTCACACTGGTAGAATTTGGAGAGAATGGAAACTTCAATAGCACCTCCCCATGTGTCTTCTCTTCTAATCCATGAGCAATATTCCTCATTACTTTTACCAAAAACAGCGTCACAGTAAGCAGACTGGTCACTGGCCACAATCTCTGCAATAAGGCTGCGCATTTCTAGGGCGCATGCTGGGTCATAGACACCCCCCTCTACCACATAATAAATGCTTGTGAACAAGCATGATTTATCTGCTGGGAACTACCTCCCGACAATTGGTTGCGTGGGCTGGTGCGTGTCGGGTTACCAAATACCGTTTTTCAAAACCGGAAAAAAATTTGGGACGGGGGGCTTACTTTTATGCGGTCTTCCTCACATAAACCTTATTCTCCCCAAATTTTAAAGGGAAAATTTTTCGTTTGGTGGGGGGTCCCCTTTTCGGGCGGCCTG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACCTCACCAAAATTGGTATGCCCGGTCTCCTTGGCATGATCCCTTGCAGCTGACTGCCCAGTCAACCCTTTCTGACACGCCATGCAACGCAGAGCAAATTGGTTTACATCTGTAAACTGCCTCTTCTTCCTAGCATCATCTGCAAGCTCCATAGCCTGTACAAGAGCTTCATCATCTGTTGTGGAAAAGACGGTCATTGGAGGCATGTCAGGATCTGGAAACTGACGTTGTAATGGATCATAGTGTATACCATCATAAATTAGTAAAACACGTTTGGTATAACCAGAATCTTCCCCAAATCTATCTATCCGTACAGTCTGAGTGTCTACCACACAAATTTCACACTGGTAGAATTTGGAGAGAATGGAAACTTCAATAGCACCTCCCCATGTGTCTTCTCTTCTAATCCATGAGCAATATTCCTCATTACTTTTACCAAAAACAGCGTCACAGTAAGCAGACTGGTCACTGGCCACAATCTCTGCAATAAGGCTGCGCATTTCTAGGGCGCATGCTGGGTCATAGACACCCCCCTCTACCACATAATAAATGCTTGTGAACAAGCATGATTTATCTGCTGGGAACTACCTCCCGACAATTGGTTGCGTGGGCTGGTGCGTGTCGGGTTACCAAATACCGTTTTTCAAAACCGGAAAAAAATTTGGGACGGGGGGCTTACTTTTATGCGGTCTTCCTCACATAAACCTTATTCTCCCCAAATTTTAAAGGGAAAATTTTTCGTTTGGTGGGGGGTCCCCTTTTCGGGCGGCCTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACCTCACCAAAATTGGTATG