ORFeome > ywhae ORF1 – XORFeome v1.0

ywhae ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ywhae
Gene ID: 996381
Gene Page ID: 996374
ORF Xenbase ID: 17305305

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045025
Original XGC clone length: 768

Human orthology & disease relationships

NCBI Entrez ID: 7531
Ensembl gene IDs: ENSG00000108953
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 115150,125853,164400,191100,211980,246200,605027,605407,606690,606952,607785,608643

Library Location

Plate ID: GDExl11013
Well Location: C06

Sequences - 5ʹ (forward) EST

Accession: JZ824100
dbEST ID: 79641802
Trimmed Sequence: ATGGAAGAGCGAGAGGATCTAGTGTACAGAGCTAAACTGGCAGAGCAGGCCGAGAGATATGACGAAATGGTGGAATCTATGAAGAAAGTTGCAGGAATGGATGTGGAATTGACAGTAGAAGAAAGAAACTTGCTCTCTGTTGCATATAAGAATGTGATTGGAGCCAGGAGAGCGTCATGGAGAATAATCAGCAGCATTGAACAGAAAGAGGAGAACAAAGGGGGAGAAGATAAACTCAAAATGATAAGGGAATATCGACAAATGGTTGAGACTGAGTTGAAATCTATCTGTAATGACATTCTGGATGTACTGGACAAGCACCTCATTCCAGCTGCAAGCAGTGGAGAGTCCAAGGTTTTTTACTATAAAATGAAAGGCGACTACCACCGATATCTGGCAGAGTTTGCTCAAGGCAATGACAGAAAGGAGGCTGCAGAGAACAGCTTGGTGGCTTACAAAGCTGCAAGTGATATCGCAATGACAGAACTTCCTCCAACACATCCAATTCGTTTAGGTCTTGCACTTAATTTCTCTGTGTTCTACTATGAAATTCTAAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCATTTGATGACGCCATTGCAGAACTGGACACACTGAGTGAAGAAAGTTACAAAGACTCCACACTTATCATGCAATTGTTACGTGATAATCTGACACTATGGACTTCAGATATGCAAGGGTGACGGTGAAGATCAGAATAAAGAAGCACTGGCAGGACGTGGAAGATGAAAAATCATTGGCAAACTTTTTTGTTCCAAATTGGGCATTATAAAAAAGCATTTGCCTTTTCAATTTTGTTGCCACGAAAAGGGTCC
Full Trace Sequence: AAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGAGCGAGAGGATCTAGTGTACAGAGCTAAACTGGCAGAGCAGGCCGAGAGATATGACGAAATGGTGGAATCTATGAAGAAAGTTGCAGGAATGGATGTGGAATTGACAGTAGAAGAAAGAAACTTGCTCTCTGTTGCATATAAGAATGTGATTGGAGCCAGGAGAGCGTCATGGAGAATAATCAGCAGCATTGAACAGAAAGAGGAGAACAAAGGGGGAGAAGATAAACTCAAAATGATAAGGGAATATCGACAAATGGTTGAGACTGAGTTGAAATCTATCTGTAATGACATTCTGGATGTACTGGACAAGCACCTCATTCCAGCTGCAAGCAGTGGAGAGTCCAAGGTTTTTTACTATAAAATGAAAGGCGACTACCACCGATATCTGGCAGAGTTTGCTCAAGGCAATGACAGAAAGGAGGCTGCAGAGAACAGCTTGGTGGCTTACAAAGCTGCAAGTGATATCGCAATGACAGAACTTCCTCCAACACATCCAATTCGTTTAGGTCTTGCACTTAATTTCTCTGTGTTCTACTATGAAATTCTAAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCATTTGATGACGCCATTGCAGAACTGGACACACTGAGTGAAGAAAGTTACAAAGACTCCACACTTATCATGCAATTGTTACGTGATAATCTGACACTATGGACTTCAGATATGCAAGGGTGACGGTGAAGATCAGAATAAAGAAGCACTGGCAGGACGTGGAAGATGAAAAATCATTGGCAAACTTTTTTGTTCCAAATTGGGCATTATAAAAAAGCATTTGCCTTTTCAATTTTGTTGCCACGAAAAGGGTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGAGCGAGAGGAT

Sequences - 3ʹ (reverse) EST

Accession: JZ829408
dbEST ID: 79647110
Trimmed Sequence: CTGATTTTCATCTTCCACGTCCTGCAGTGCTTCTTTATTCTGATCTTCACCGTCACCTTGCATATCTGAAGTCCATAGTGTCAGATTATCACGTAACAATTGCATGATAAGTGTGGAGTCTTTGTAACTTTCTTCACTCAGTGTGTCCAGTTCTGCAATGGCGTCATCAAATGCTGCTTTTGCCAACCTGCAGGCACGGTCAGGGGAATTTAGAATTTCATAGTAGAACACAGAGAAATTAAGTGCAAGACCTAAACGAATTGGATGTGTTGGAGGAAGTTCTGTCATTGCGATATCACTTGCAGCTTTGTAAGCCACCAAGCTGTTCTCTGCAGCCTCCTTTCTGTCATTGCCTTGAGCAAACTCTGCCAGATATCGGTGGTAGTCGCCTTTCATTTTATAGTAAAAAACCTTGGACTCTCCACTGCTTGCAGCTGGAATGAGGTGCTTGTCCAGTACATCCAGAATGTCATTACAGATAGATTTCAACTCAGTCTCAACCATTTGTCGATATTCCCTTATCATTTTGAGTTTATCTTCTCCCCCTTTGTTCTCCTCTTTCTGTTTCATGCTGCTGATTATTCTCCATGACGCTCTCCCGGCTCCCATCACATTTCTATATGCCACAAAGAGCAAGTTTCTTTCCTCCTTCTGCAATTCCACCTCCATTTCCTGCAACTTTCTTTCAAAAATCCCCCATTTTCCTCATATCCTTTCCGGCCTGCTTCCGCCCCGTTTTAGCCTCGGTTACCCTTAAAA
Full Trace Sequence: ACGTGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGATTTTCATCTTCCACGTCCTGCAGTGCTTCTTTATTCTGATCTTCACCGTCACCTTGCATATCTGAAGTCCATAGTGTCAGATTATCACGTAACAATTGCATGATAAGTGTGGAGTCTTTGTAACTTTCTTCACTCAGTGTGTCCAGTTCTGCAATGGCGTCATCAAATGCTGCTTTTGCCAACCTGCAGGCACGGTCAGGGGAATTTAGAATTTCATAGTAGAACACAGAGAAATTAAGTGCAAGACCTAAACGAATTGGATGTGTTGGAGGAAGTTCTGTCATTGCGATATCACTTGCAGCTTTGTAAGCCACCAAGCTGTTCTCTGCAGCCTCCTTTCTGTCATTGCCTTGAGCAAACTCTGCCAGATATCGGTGGTAGTCGCCTTTCATTTTATAGTAAAAAACCTTGGACTCTCCACTGCTTGCAGCTGGAATGAGGTGCTTGTCCAGTACATCCAGAATGTCATTACAGATAGATTTCAACTCAGTCTCAACCATTTGTCGATATTCCCTTATCATTTTGAGTTTATCTTCTCCCCCTTTGTTCTCCTCTTTCTGTTTCATGCTGCTGATTATTCTCCATGACGCTCTCCCGGCTCCCATCACATTTCTATATGCCACAAAGAGCAAGTTTCTTTCCTCCTTCTGCAATTCCACCTCCATTTCCTGCAACTTTCTTTCAAAAATCCCCCATTTTCCTCATATCCTTTCCGGCCTGCTTCCGCCCCGTTTTAGCCTCGGTTACCCTTAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGATTTTCATCTTCCACGTCCT