ORFeome > ywhaz ORF1 – XORFeome v1.0

ywhaz ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ywhaz
Gene ID: 6256657
Gene Page ID: 970615
ORF Xenbase ID: 17305335

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056850
Original XGC clone length: 738

Human orthology & disease relationships

NCBI Entrez ID: 7534
Ensembl gene IDs: ENSG00000164924
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,115150,115200,123500,125853,131760,131800,131900,131960,151623,164400,166200,166210,172700,179850,191100,211980,215600,231200,233710,246200,260540,275355,600274,601104,601665,605027,605407,606690,606952,607485,608232,608643,609040,609352

Library Location

Plate ID: GDExl11001
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ839242
dbEST ID: 79656944
Trimmed Sequence: ATGGATAAAAATGAACTGGTCCAGAAGGCCAAGTTGGCTGAACGGGCAGAGCGATACGATGACATGGCTGCTTGTATGAAGAGAGTTACAGAGGAGGGAGGTGAACTATCCAATGAAGAAAGGAACCTTCTCTCGGTGGCCTACAAAAATGTAGTGGGTGCACGTCGGTCGTCCTGGCGGGTGGTGTCTAGCATTGAGCAGAAGACGGAAGGAGCTGAAAAGAAACAGGAAATGTCGCGAGAATACAGGGAGAAGATTGAGGCTGAATTGAGAGAAATCTGCAATGATGTTCTGAATCTTCTGGACAAATTCTTGATTGCCAATGCCACGCAACCAGAAAGCAAAGTTTTCTATTTGAAAATGAAGGGTGATTATTATCGTTACTTGGCTGAAGTAGCCGCTGGCAATGCAAAGACAGAAATCGTGGGCCAGTCACAGAAGGCGTATCAAGATGCCTTTGACATCAGCAAAACTGAAATGCAACCAACACATCCCATCCGATTGGGTCTGGCCCTGAACTTCTCTGTGTTCTACTATGAGATCCTCAACTGTCCAGATAAAGCATGTGCTCTCGCCGAGGCCGCTTTTGATGAAGCCATTGCTGAGCTTGACACTTTGAGTGAAGAGTCCTACNAAGACAGCACATTAATAATGCAGTTACTGAGAGACAACTTAACATTGTGGACATCCGACACCCAAGGGGATGAAGCTGAACAAAGGAAAAGGAAGGGGAGAACTTTGCCAACTTTCTTGGTCCAAGTTTGGCATTTAAAGAAAAAGCATTTGCTTTTAATAATTTG
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATAAAAATGAACTGGTCCAGAAGGCCAAGTTGGCTGAACGGGCAGAGCGATACGATGACATGGCTGCTTGTATGAAGAGAGTTACAGAGGAGGGAGGTGAACTATCCAATGAAGAAAGGAACCTTCTCTCGGTGGCCTACAAAAATGTAGTGGGTGCACGTCGGTCGTCCTGGCGGGTGGTGTCTAGCATTGAGCAGAAGACGGAAGGAGCTGAAAAGAAACAGGAAATGTCGCGAGAATACAGGGAGAAGATTGAGGCTGAATTGAGAGAAATCTGCAATGATGTTCTGAATCTTCTGGACAAATTCTTGATTGCCAATGCCACGCAACCAGAAAGCAAAGTTTTCTATTTGAAAATGAAGGGTGATTATTATCGTTACTTGGCTGAAGTAGCCGCTGGCAATGCAAAGACAGAAATCGTGGGCCAGTCACAGAAGGCGTATCAAGATGCCTTTGACATCAGCAAAACTGAAATGCAACCAACACATCCCATCCGATTGGGTCTGGCCCTGAACTTCTCTGTGTTCTACTATGAGATCCTCAACTGTCCAGATAAAGCATGTGCTCTCGCCGAGGCCGCTTTTGATGAAGCCATTGCTGAGCTTGACACTTTGAGTGAAGAGTCCTACNAAGACAGCACATTAATAATGCAGTTACTGAGAGACAACTTAACATTGTGGACATCCGACACCCAAGGGGATGAAGCTGAACAAAGGAAAAGGAAGGGGAGAACTTTGCCAACTTTCTTGGTCCAAGTTTGGCATTTAAAGAAAAAGCATTTGCTTTTAATAATTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATAAAAATGAACTGGTCCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839241
dbEST ID: 79656943
Trimmed Sequence: GTTCTCCCCTCCTTCTCCTTGTTCAGCTTCATCCCCTTGGGTGTCTGATGTCCACAATGTTAAGTTGTCTCTCAGTAACTGCATTATTAATGTGCTGTCTTTGTAGGACTCTTCACTCAAAGTGTCAAGCTCAGCAATGGCTTCATCAAAAGCGGCCTCGGCGAGAGCACATGCTTTATCTGGACAGTTGAGGATCTCATAGTAGAACACAGAGAAGTTCAGGGCCAGACCCAATCGGATTGGATGTGTTGGTTGCATTTCAGTTTTGCTGATGTCAAAGGCATCTTGATACGCCTTCTGTGACTGGCCCACGATTTCTGTCTTTGCATTGCCAGCGGCTACTTCAGCCAAGTAACGATAATAATCACCCTTCATTTTCAAATAGAAAACTTTGCTTTCTGGTTGCGTGGCATTGGCAATCAAGAATTTGTCCAGAAGATTCAGAACATCATTGCAGATTTCTCTCAATTCAGCCTCAATCTTCTCCCTGTATTCTCGCGACATTTCCTGTTTCTTTTCAGCTCCTTCCGTCTTCTGCTCAATGCTAGACACCACCCCGCCAGGACAACCGACGTGCACCCACTACATTTTTTGTATGCCACCGAAAAAAAGTTCCCTTTCTTCCTTGGATAGTTCACCTCCCCCCCTCTTTAACTCTCTTCAACAAGCCAAGCCCTGTCATCCCTATCGCTTT
Full Trace Sequence: GCCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTCTCCCCTCCTTCTCCTTGTTCAGCTTCATCCCCTTGGGTGTCTGATGTCCACAATGTTAAGTTGTCTCTCAGTAACTGCATTATTAATGTGCTGTCTTTGTAGGACTCTTCACTCAAAGTGTCAAGCTCAGCAATGGCTTCATCAAAAGCGGCCTCGGCGAGAGCACATGCTTTATCTGGACAGTTGAGGATCTCATAGTAGAACACAGAGAAGTTCAGGGCCAGACCCAATCGGATTGGATGTGTTGGTTGCATTTCAGTTTTGCTGATGTCAAAGGCATCTTGATACGCCTTCTGTGACTGGCCCACGATTTCTGTCTTTGCATTGCCAGCGGCTACTTCAGCCAAGTAACGATAATAATCACCCTTCATTTTCAAATAGAAAACTTTGCTTTCTGGTTGCGTGGCATTGGCAATCAAGAATTTGTCCAGAAGATTCAGAACATCATTGCAGATTTCTCTCAATTCAGCCTCAATCTTCTCCCTGTATTCTCGCGACATTTCCTGTTTCTTTTCAGCTCCTTCCGTCTTCTGCTCAATGCTAGACACCACCCCGCCAGGACAACCGACGTGCACCCACTACATTTTTTGTATGCCACCGAAAAAAAGTTCCCTTTCTTCCTTGGATAGTTCACCTCCCCCCCTCTTTAACTCTCTTCAACAAGCCAAGCCCTGTCATCCCTATCGCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTCTCCCCTCCTTCTCCT