ORFeome > zbtb8a.1 ORF1 – XORFeome v1.0

zbtb8a.1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: zbtb8a.1
Gene ID: 866345
Gene Page ID: 494385
ORF Xenbase ID: 17305437

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123247
Original XGC clone length: 1413

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ838220
dbEST ID: 79655922
Trimmed Sequence: ATGGAATTCTCTTCCCATCACATTCGTCTTCTGCAGCAGTTGGATGAACAGCGGCAGAAGGATCTCTTTTGTGACTGTCACATTATAGTGGAAGGGCAGATGTTTAAAGCACATCGTAATGTACTGTTTGCCAGTAGTGGTTACTTCAAAATGCTTCTGTCTCAAAGCTGCAGGGACATGGGTGAGCCAATCACAGCCACCTTTGATGTGTTTTCTGCTGACACGTTTACAGCCATCCTAGACTTTGTTTATTCAGGCAAATTGCCTCTTTCTGGACAAAATGTTATTGAGGTTATGTCTGCAGCCAGCTATCTTCAAATGACCGATGTTATTGGTGTTTGCAAAATGTTTATCAAATCCTCCTTGGACATAAATGAGAAGGACAGAGATGGTTTCTTCAGCCTTTCAGACAAGGATGCTGGCAGTAATGGTTCTGGGCTTTATGCTGCAGGTTGGAGGACTGAGAGCAGCCCAACACATACACATGATACAGCAGAGCATGGCAGCTTTATTGCTGGTTATAATTACCCCCCTCCAATTACCTCACGGTTGCAGCGCCCTTTCTCTAAGCACCCACGCAAACCTGAGCTTGTTCGCAAGCATCGTAGGCGCCTACTGCCAGAACCTCTGACGCCGCACCACTCAGTCATATTCCACTGGGTGACTTGGTGGGAGGCTCAGCAGAATGTATGCTGCATGATTAAGAAACAAGTTAAAATTGTGTCACAAGGAAGAAA
Full Trace Sequence: GGAATTTTTTTATTTTCGACTGGGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAATTCTCTTCCCATCACATTCGTCTTCTGCAGCAGTTGGATGAACAGCGGCAGAAGGATCTCTTTTGTGACTGTCACATTATAGTGGAAGGGCAGATGTTTAAAGCACATCGTAATGTACTGTTTGCCAGTAGTGGTTACTTCAAAATGCTTCTGTCTCAAAGCTGCAGGGACATGGGTGAGCCAATCACAGCCACCTTTGATGTGTTTTCTGCTGACACGTTTACAGCCATCCTAGACTTTGTTTATTCAGGCAAATTGCCTCTTTCTGGACAAAATGTTATTGAGGTTATGTCTGCAGCCAGCTATCTTCAAATGACCGATGTTATTGGTGTTTGCAAAATGTTTATCAAATCCTCCTTGGACATAAATGAGAAGGACAGAGATGGTTTCTTCAGCCTTTCAGACAAGGATGCTGGCAGTAATGGTTCTGGGCTTTATGCTGCAGGTTGGAGGACTGAGAGCAGCCCAACACATACACATGATACAGCAGAGCATGGCAGCTTTATTGCTGGTTATAATTACCCCCCTCCAATTACCTCACGGTTGCAGCGCCCTTTCTCTAAGCACCCACGCAAACCTGAGCTTGTTCGCAAGCATCGTAGGCGCCTACTGCCAGAACCTCTGACGCCGCACCACTCAGTCATATTCCACTGGGTGACTTGGTGGGAGGCTCAGCAGAATGTATGCTGCATGATTAAGAAACAAGTTAAAATTGTGTCACAAGGAAGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAATTCTCTTCCCATCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838219
dbEST ID: 79655921
Trimmed Sequence: GTCTTGTTTTTCTTTCAACTCATCATCTTCGCTGTCTACCACCTCCTGTATAGCTAGGTCTGACTCTGCACGCTCACTCCCATTTTCCTTTCTTCCTTCTTCCTTGAAATTCCAGCAATGTTCCCTCTCATTTTCAGGTGGTAACACCAATGGCTGGTCTTCTCCATAGTCAAAGTTGACGTTATCCAAGCCAGCTTCTGCCAAACATGCATGGCAAAGGCGGTATCTCCTTGTCCCATCCTGAATAACACGACCGGTTACTTTGGTTACTGGAAGTTTGCACCTTCGACAGATTAGTTTACCAGCCTCATGAATTGTCTGAAAGTGATTGCGCAAGTGCTCCAGTCTAGTGAACCTCTTGCCACAGGCTTCACATGGGTAAGGTCGCTCTCCTGTGTGGCATCGCAGGTGACGTTTTAAATCGGCTTTACGTTTCACGGTATGGGTGCAGAAAGGGCATTTAAACCTCCCAGAACTTAGTTCATCTTCACCCCATCCAGATACTCCTCCCAGCATGGTAGGCATTGCCTTGTACAGCTCTTCTGCCTTGGTTATATGAAGAGCTGGACCCTGGTCCAGAGACTCTTGCTGAGGAGATTCAGGCCAGCTGTGAGATGCAGCATCTTCCTCCTCATCTTTAATACTTATTTATGGACTCCCTGTGGTTTTGGGTTCTTTTCCTCCTCCCTGTTAACA
Full Trace Sequence: GAAACAGACTATTGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTTGTTTTTCTTTCAACTCATCATCTTCGCTGTCTACCACCTCCTGTATAGCTAGGTCTGACTCTGCACGCTCACTCCCATTTTCCTTTCTTCCTTCTTCCTTGAAATTCCAGCAATGTTCCCTCTCATTTTCAGGTGGTAACACCAATGGCTGGTCTTCTCCATAGTCAAAGTTGACGTTATCCAAGCCAGCTTCTGCCAAACATGCATGGCAAAGGCGGTATCTCCTTGTCCCATCCTGAATAACACGACCGGTTACTTTGGTTACTGGAAGTTTGCACCTTCGACAGATTAGTTTACCAGCCTCATGAATTGTCTGAAAGTGATTGCGCAAGTGCTCCAGTCTAGTGAACCTCTTGCCACAGGCTTCACATGGGTAAGGTCGCTCTCCTGTGTGGCATCGCAGGTGACGTTTTAAATCGGCTTTACGTTTCACGGTATGGGTGCAGAAAGGGCATTTAAACCTCCCAGAACTTAGTTCATCTTCACCCCATCCAGATACTCCTCCCAGCATGGTAGGCATTGCCTTGTACAGCTCTTCTGCCTTGGTTATATGAAGAGCTGGACCCTGGTCCAGAGACTCTTGCTGAGGAGATTCAGGCCAGCTGTGAGATGCAGCATCTTCCTCCTCATCTTTAATACTTATTTATGGACTCCCTGTGGTTTTGGGTTCTTTTCCTCCTCCCTGTTAACA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTTGTTTTTCTTTCAACTCATC