ORFeome > zbtb8a.1 ORF2 – XORFeome v1.0

zbtb8a.1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: zbtb8a.1
Gene ID: 6255849
Gene Page ID: 494385
ORF Xenbase ID: 17305443

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC129718
Original XGC clone length: 1410

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: C09

Sequences - 5ʹ (forward) EST

Accession: JZ838966
dbEST ID: 79656668
Trimmed Sequence: ATGGAATTCTCTTCCCACCACATCCGTCTTCTGCAGCAGTTGGATGAACAGCGGCGGAGGGATCTTTTTTGTGACTGTCACATTATAGTAGAGGGGCAGATGTTTAAAGCACATCGTAATGTGCTGTTTGCTAGCAGTGGTTACTTCAAAATGCTTCTGTCCCAAAGCTGCAGGGACATGGGTGAGCCAATCACAGCCACCTTTGATGTGTTTTCTGCTGATACCTTTACAGCCATTCTCGACTTTGTTTACTCAGGCAAATTGCCACTTTCTGGACAAAATGTTATTGAGGTTATGTCTGCAGCCAGCTATCTTCAAATGACAGATGTTATTGGTGTTTGCAAGATGTTTATCAAATCCTCATTAGACATAAACGAGAAGGATAGAGATGGTTTCTTCAGCCTTTCAGACAAGGACACTGACAGTAATGGTTCTGGGCTTTATGCTGCAGGTTGGAGGACAGAGAGCAACCCAACACATACACACAAGACCACCGAGCATGGCAGCTTTATTGCTGGTTATAATTACCCCCCTCCAATTTCCTCCCGGTTGCAGCACCCTTTCTCAAAGTCCCCACGAAAACCTGAGCTTGTTCGTAAGCATCGTAAGCGCCTACTGCCAGAAGCTCTGACACCAGCGCTCAGTCATATTCCACTGGAGTGACTTGGTGGGAGGCTCAGCAGAGTGTATGCTGCACGATGAGGAGACAGTTAAGAGTGTGTCCCAGGAAGAAGAAAGAACCAAACACAAATGTCATAAAAAGTAATTAATTTAAAGATTAAATTCTAAAACTTAAACCCCTGCCCTTAATCTCCTCCCCAAAAAATTC
Full Trace Sequence: GGGGGGCCCAAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAATTCTCTTCCCACCACATCCGTCTTCTGCAGCAGTTGGATGAACAGCGGCGGAGGGATCTTTTTTGTGACTGTCACATTATAGTAGAGGGGCAGATGTTTAAAGCACATCGTAATGTGCTGTTTGCTAGCAGTGGTTACTTCAAAATGCTTCTGTCCCAAAGCTGCAGGGACATGGGTGAGCCAATCACAGCCACCTTTGATGTGTTTTCTGCTGATACCTTTACAGCCATTCTCGACTTTGTTTACTCAGGCAAATTGCCACTTTCTGGACAAAATGTTATTGAGGTTATGTCTGCAGCCAGCTATCTTCAAATGACAGATGTTATTGGTGTTTGCAAGATGTTTATCAAATCCTCATTAGACATAAACGAGAAGGATAGAGATGGTTTCTTCAGCCTTTCAGACAAGGACACTGACAGTAATGGTTCTGGGCTTTATGCTGCAGGTTGGAGGACAGAGAGCAACCCAACACATACACACAAGACCACCGAGCATGGCAGCTTTATTGCTGGTTATAATTACCCCCCTCCAATTTCCTCCCGGTTGCAGCACCCTTTCTCAAAGTCCCCACGAAAACCTGAGCTTGTTCGTAAGCATCGTAAGCGCCTACTGCCAGAAGCTCTGACACCAGCGCTCAGTCATATTCCACTGGAGTGACTTGGTGGGAGGCTCAGCAGAGTGTATGCTGCACGATGAGGAGACAGTTAAGAGTGTGTCCCAGGAAGAAGAAAGAACCAAACACAAATGTCATAAAAAGTAATTAATTTAAAGATTAAATTCTAAAACTTAAACCCCTGCCCTTAATCTCCTCCCCAAAAAATTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAATTCTCTTCCCACCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838965
dbEST ID: 79656667
Trimmed Sequence: GTCTTGTTTTTGCTTCAACTCATCCTCTTCACTGTCTACCACTTCCTGAATAACTAGGTCTGACTCTGCAGCTTCACTCCCATTTTCTTGCCTTCCTTCTTCTTTAAAATTCCAGCAATGTTCCCTCTCATTTTCAGGTGGCAACACCAATGGTTGGTCTTCTCCATAGTCAAAGTTGACGTTATCCAAACCAGCTTCTGCCAGACATGCTTGGCAAAGGCGGTACCTCCTTGTCCCATCCTGAATAACACGACCAGTTACTTTGGTTACAGGAAGTTTGCACCTCCGACAGATTAGTTTACCAGCCTCGTGTATTGTCTGAAAGTGATTACGCAAGTGCTCCAATCGGGTGAACCTCTTGCCACAGGCTTCACAAGGGTATGGTCGCTCTCCTGTGTGGCAGCGCAAGTGACGTTTTAGATCTGCTTTGCGTTTCACGGTATGGGTGCAGAAAGGGCATTTAAACCTCCCAGAGCTTAGTTCATCTTCACCCCATCCAGATACTCCTCCTAAGATGGTAGGCATTGCTTTGTACAGCTCTTCTGCCTTGGTTATATGAAGAGCTGAACCCTGATCCAGAGACTCTTGCGGAGGAGATTCANGCCAGCTGTTAGATGTAGCATCTAAATCCTCAACTTTAATACTTATTATTGGAACATTTTTGTTTGGGGTTCTTTCCTCTTCCTGTTACACACTTCTCAACTGGTCTCTTCATCCTTCACCCAAACCCTTCTGGTTTAACCTCCCCCCCAAATTCCCCCCCAATGGAAAA
Full Trace Sequence: AAAAAGTCTATTGACCATGTAATACGACTCACTATANGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTTGTTTTTGCTTCAACTCATCCTCTTCACTGTCTACCACTTCCTGAATAACTAGGTCTGACTCTGCAGCTTCACTCCCATTTTCTTGCCTTCCTTCTTCTTTAAAATTCCAGCAATGTTCCCTCTCATTTTCAGGTGGCAACACCAATGGTTGGTCTTCTCCATAGTCAAAGTTGACGTTATCCAAACCAGCTTCTGCCAGACATGCTTGGCAAAGGCGGTACCTCCTTGTCCCATCCTGAATAACACGACCAGTTACTTTGGTTACAGGAAGTTTGCACCTCCGACAGATTAGTTTACCAGCCTCGTGTATTGTCTGAAAGTGATTACGCAAGTGCTCCAATCGGGTGAACCTCTTGCCACAGGCTTCACAAGGGTATGGTCGCTCTCCTGTGTGGCAGCGCAAGTGACGTTTTAGATCTGCTTTGCGTTTCACGGTATGGGTGCAGAAAGGGCATTTAAACCTCCCAGAGCTTAGTTCATCTTCACCCCATCCAGATACTCCTCCTAAGATGGTAGGCATTGCTTTGTACAGCTCTTCTGCCTTGGTTATATGAAGAGCTGAACCCTGATCCAGAGACTCTTGCGGAGGAGATTCANGCCAGCTGTTAGATGTAGCATCTAAATCCTCAACTTTAATACTTATTATTGGAACATTTTTGTTTGGGGTTCTTTCCTCTTCCTGTTACACACTTCTCAACTGGTCTCTTCATCCTTCACCCAAACCCTTCTGGTTTAACCTCCCCCCCAAATTCCCCCCCAATGGAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTTGTTTTTGCTTCAACTCATC