ORFeome > zc3h14 ORF1 – XORFeome v1.0

zc3h14 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: zc3h14
Gene ID: 983051
Gene Page ID: 983047
ORF Xenbase ID: 17305473

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC124947
Original XGC clone length: 2061

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ837312
dbEST ID: 79655014
Trimmed Sequence: ATGGTTGCCAATAAGAAAAGTCAGAAGCAGATGAAGGAAGAACCGGTCATTATTCCTTGGAAGCAACACAACCAGATTCACAACTTGGCTGCAGGGAGTACTGGATAAACTGCGCTCTGTCACTCCAGAGTCCAACAGCATGAAGACTTCAGATGCTATTATATTTGAAAGCAGCATGCCATCACTTAAAAGTCTATCCAACAGCAGGGATGATTTGGCGAAAGATGTTCCAACTCTCACAGTCTCCAGCACAAGACATGGAAGATATGATTCATCCACCAGCTCACACGTGCACAAGCCAGCGACTT
Full Trace Sequence: TGAGTCGAGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTTGCCAATAAGAAAAGTCAGAAGCAGATGAAGGAAGAACCGGTCATTATTCCTTGGAAGCAACACAACCAGATTCACAACTTGGCTGCAGGGAGTACTGGATAAACTGCGCTCTGTCACTCCAGAGTCCAACAGCATGAAGACTTCAGATGCTATTATATTTGAAAGCAGCATGCCATCACTTAAAAGTCTATCCAACAGCAGGGATGATTTGGCGAAAGATGTTCCAACTCTCACAGTCTCCAGCACAAGACATGGAAGATATGATTCATCCACCAGCTCACACGTGCACAAGCCAGCGACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGAGCAAAATAAGACCTATACACAATTATCATCATGTCTCATCTAGGGCACTGAGGAGAGACATGCAACAACTTAACAGCTACCGAGAGATGCGGGGTGACGCTTCCGCGGTATATTGGATGATGGACGAACCCAGGAGACTACACCTGCTCCGGTCGTAAACTGTAATGTAGGTACGAGCGCCCCCCACCCGAGGGGTCCAGACCTTGACAGACCCCAACCGTGAGAAGCGGCGCAAGGGCGGGTTTTATGGGTTTTTTTATAATGGTTTTTTTTTTTTGTAAAAGCTTAACCCCCCCCCGCCCACCCACACG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTTGCCAATAAGAAAAGTCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837311
dbEST ID: 79655013
Trimmed Sequence: GTCGCTGGCTTGTGCACGTGTGAGCTGGTGGATGAATCATATCTTCCATGTCTTGTGCTGGAGACTGTGAGAGTTGGAACATCTTTCGCCAAATCATCCCTGCTGTTGGATAGACTTTTAAGTGATGGCATGCTGCTTTCAAATATAATAGCATCTGAAGTCTTCATGCTGTTGGACTCTGGAGTGACAGAGCGCAGTTTATCCAGTACTCCCTGCAGCCAAGTTGTGAATCTGGTTGTGTTGCTTCCAAGGAATAATGACAGGTCATCCGTCATCTGCTTCTGACTTTTCTTATTGGCAACCATGG
Full Trace Sequence: GGGAAAAGTCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCGCTGGCTTGTGCACGTGTGAGCTGGTGGATGAATCATATCTTCCATGTCTTGTGCTGGAGACTGTGAGAGTTGGAACATCTTTCGCCAAATCATCCCTGCTGTTGGATAGACTTTTAAGTGATGGCATGCTGCTTTCAAATATAATAGCATCTGAAGTCTTCATGCTGTTGGACTCTGGAGTGACAGAGCGCAGTTTATCCAGTACTCCCTGCAGCCAAGTTGTGAATCTGGTTGTGTTGCTTCCAAGGAATAATGACAGGTCATCCGTCATCTGCTTCTGACTTTTCTTATTGGCAACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCATAATAGGAAAAAATATATGATATCGTCAATGCCAGACTAGGGCACTGCCGAGAGACAAGCAAAAACAAAGGTGCAATCCGAAAGATGCGGGCTGACGGTAACTTGGTGGTCGGTGAATGACCGATCCCCGTAGTAGTAAAACCTATTCGGGTAGGTGATCTGAAACGTAGGTACCTTTGCCTCTGAACCACTGTGGTCAAAAAACTTGAACAAACCCAAGCGGTGGTAAAGGGGCCAAGTGCCGGTTCTCAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCGCTGGCTTGTGCACGTGT