ORFeome > zfand2b ORF1 – XORFeome v1.0

zfand2b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: zfand2b
Gene ID: 5994984
Gene Page ID: 5994974
ORF Xenbase ID: 17305629

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC122499
Original XGC clone length: 792

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ838030
dbEST ID: 79655732
Trimmed Sequence: ATGGAGTTTCCTGACCTAGGGAAGCATTGCTCTGAGACAACATGCAAACAGCTTGATTTCCTGCCTTTAAAGTGTGATGCCTGTGAGCAAATATTCTGCAAAGATCACATCGCTTACGCACAGCACCAATGCAGTTCAGCATATAAAAAGGATGTCCAGGTTCCTGTTTGCCCCCTATGCAATACCCCAATCCCAGTAACAAGAGGACAGACTCCTGATGTTGTTGTTGGTGAACACATTGATCAGGACTGCAAGTCTGACCCAGCTAGGCAGAAGCGGAAGATTTTCACTAACAAGTGTGCGAAGCCAGGCTGCCGACAGAAAGAGCTAATGAAGGTGATTTGTGAGGATTGCCATGGAAACTTCTGCCTCAAGCACAGACACCCACTTGATCATGACTGCAAGGGGAAGAGCGCTCCCATTTCCAGGGCTGGTCATGTGGCTTTGCTGAGATCCCAGGCTTCCACTTCAAAGGCATCAGCGTATTCCAGTCATGCAGCACCAAAACCAGCCATACAGCCTCCTCTTAGCAGGACAAGTGTCCCCAGCGCTCAACCTCCTGCTGCTGCATCTTTGCAAAATGGGTTGACAGAGGAAAAGGCTCTCCCAAAGGCACTAAAAATGTCACTTTTCGAATCTGCTGGAACTGCAGCCCAGTCCGGCAACTCTCAAAAGGAAAAAAGAATTTGCTCCTGGCCCAGCCTTTCTTACCCAATGGAGGAGAAAATGAGGCAAAGACAGGCGAACCCCGGGAACAAAATCCAAAAAAGCCAAACCGTTCTTTTTTTGCAATTATTTTTTTT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGTTTCCTGACCTAGGGAAGCATTGCTCTGAGACAACATGCAAACAGCTTGATTTCCTGCCTTTAAAGTGTGATGCCTGTGAGCAAATATTCTGCAAAGATCACATCGCTTACGCACAGCACCAATGCAGTTCAGCATATAAAAAGGATGTCCAGGTTCCTGTTTGCCCCCTATGCAATACCCCAATCCCAGTAACAAGAGGACAGACTCCTGATGTTGTTGTTGGTGAACACATTGATCAGGACTGCAAGTCTGACCCAGCTAGGCAGAAGCGGAAGATTTTCACTAACAAGTGTGCGAAGCCAGGCTGCCGACAGAAAGAGCTAATGAAGGTGATTTGTGAGGATTGCCATGGAAACTTCTGCCTCAAGCACAGACACCCACTTGATCATGACTGCAAGGGGAAGAGCGCTCCCATTTCCAGGGCTGGTCATGTGGCTTTGCTGAGATCCCAGGCTTCCACTTCAAAGGCATCAGCGTATTCCAGTCATGCAGCACCAAAACCAGCCATACAGCCTCCTCTTAGCAGGACAAGTGTCCCCAGCGCTCAACCTCCTGCTGCTGCATCTTTGCAAAATGGGTTGACAGAGGAAAAGGCTCTCCCAAAGGCACTAAAAATGTCACTTTTCGAATCTGCTGGAACTGCAGCCCAGTCCGGCAACTCTCAAAAGGAAAAAAGAATTTGCTCCTGGCCCAGCCTTTCTTACCCAATGGAGGAGAAAATGAGGCAAAGACAGGCGAACCCCGGGAACAAAATCCAAAAAAGCCAAACCGTTCTTTTTTTGCAATTATTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTTTCCTGACCTAGGGAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838029
dbEST ID: 79655731
Trimmed Sequence: TGAAATGTTGCACATAGACCGTTTGGCATTTCGATTCTGTCCTTGGATCGCCTGCTGTTGCCTGTATTCCTCCTCACTTGCTGAGAGAGCTTGTGCCAGAGCTAAATCCTCTTCCTCTTGAGAGTTGCCCGACTGTGCTGCAGCTCCAGCAGATTCTGAAAGTGACATTTCTAGTGCCCTCTGGAGAGCCTCTTCCTCTGTCAACCCATTTTGCAAAGATGCAGCAGCAGGAGGTTGAGCGCTGGGGACACTTGTCCTGCTAAGAGGAGGCTGTATGGCTGGTTTTGGTGCTGCATGACTGGAATACGCTGATGCCTTTGAAGTGGAAGCCTGGGATCTCAGCAAAGCCACATGACCAGCCCTGGAAATGGGAGCGCTCTTCCCCTTGCAGTCATGATCAAGTGGGTGTCTGTGCTTGAGGCAGAAGTTTCCATGGCAATCCTCACAAATCACCTTCATTAGCTCTTTCTGTCGGCAGCCTGGCTTCGCACACTTGTTAATGAAAATCTTCCGCTTCTGCCTAACTGGGTCAGACTTGCAGTCCTGATCAATGTGTTCACCAACCACCACATCAGGAGTCTGTCCTCCTGTTACTGGGATTGGGGTAATTCATTAGGGGGCCAGACGGGGAGCCTGGAAAATCCTTTTTTAGATGCTAAAACTGCATTGGTGCCTTTGCGGAAGGCAAGTTTATCCTTGTGCGAAAGAAGTTTTCTCCAAGGGCCGTCCCACCTTTTTAAGGGGCCAAGGAAAGTCAAAGGCGTTTG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGAAATGTTGCACATAGACCGTTTGGCATTTCGATTCTGTCCTTGGATCGCCTGCTGTTGCCTGTATTCCTCCTCACTTGCTGAGAGAGCTTGTGCCAGAGCTAAATCCTCTTCCTCTTGAGAGTTGCCCGACTGTGCTGCAGCTCCAGCAGATTCTGAAAGTGACATTTCTAGTGCCCTCTGGAGAGCCTCTTCCTCTGTCAACCCATTTTGCAAAGATGCAGCAGCAGGAGGTTGAGCGCTGGGGACACTTGTCCTGCTAAGAGGAGGCTGTATGGCTGGTTTTGGTGCTGCATGACTGGAATACGCTGATGCCTTTGAAGTGGAAGCCTGGGATCTCAGCAAAGCCACATGACCAGCCCTGGAAATGGGAGCGCTCTTCCCCTTGCAGTCATGATCAAGTGGGTGTCTGTGCTTGAGGCAGAAGTTTCCATGGCAATCCTCACAAATCACCTTCATTAGCTCTTTCTGTCGGCAGCCTGGCTTCGCACACTTGTTAATGAAAATCTTCCGCTTCTGCCTAACTGGGTCAGACTTGCAGTCCTGATCAATGTGTTCACCAACCACCACATCAGGAGTCTGTCCTCCTGTTACTGGGATTGGGGTAATTCATTAGGGGGCCAGACGGGGAGCCTGGAAAATCCTTTTTTAGATGCTAAAACTGCATTGGTGCCTTTGCGGAAGGCAAGTTTATCCTTGTGCGAAAGAAGTTTTCTCCAAGGGCCGTCCCACCTTTTTAAGGGGCCAAGGAAAGTCAAAGGCGTTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAAATGTTGCACATAGACCGTT