ORFeome > zfand6 ORF1 – XORFeome v1.0

zfand6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: zfand6
Gene ID: 950129
Gene Page ID: 950122
ORF Xenbase ID: 17305659

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042359
Original XGC clone length: 615

Human orthology & disease relationships

NCBI Entrez ID: 54469
Ensembl gene IDs: ENSG00000086666
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 253300,253400,253550,600334,603689,604145,608807,608808

Library Location

Plate ID: GDExl11009
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ823739
dbEST ID: 79641441
Trimmed Sequence: ATGATTATGGCGCAGGAGACAAACCACAGCCAAGCACCACTACTATGTTCAACAGGTTGTGGCTTCTACGGTAATCCTCGAACGAATGGTCTCTGTTCCGTGTGCTATAAAGAGCATCTACAGAGGCAAAACAACAGTGGTGGGAGAAATAGTCCTCCAGTTGTGTCGGTAGGAAGTGGAGTGGAGGCATCAACCCCACAGAATGCAGAGAGCTCACAGGCAGGTGATGTAGCAGATCCTGTGGTTCCACAGACTACACAGGCCAGCTCGTTGCCACTTTTGGAAACTGGGTCGTCATCTTCACAAGCTGAAAATGCAGATAGCAGAACTACAGATACAAAAGAAATACAAGCTGCAACATCAGACAGTTCACAGAACTCCTCCGAGGAGCTTGAACGCTCTCCTGAAAAAGCCAAGCTGAAAAAGAACCGTTGCTTTATGTGCCGTAAAAAGATTGGACTCACTGGGTTCGAATGTCGATGTGGAAACGTATTCTGCGGGACTCACCGTTATTCTGATGTGCACAGTTGCTCTTATGACTACAAAGCGGATGCAGCTGAGAAGATCAGGAAAGAAAATCCAGTTGTGGTTGGAGAAAAGATTCAGAAGATATT
Full Trace Sequence: CCAGTAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTATGGCGCAGGAGACAAACCACAGCCAAGCACCACTACTATGTTCAACAGGTTGTGGCTTCTACGGTAATCCTCGAACGAATGGTCTCTGTTCCGTGTGCTATAAAGAGCATCTACAGAGGCAAAACAACAGTGGTGGGAGAAATAGTCCTCCAGTTGTGTCGGTAGGAAGTGGAGTGGAGGCATCAACCCCACAGAATGCAGAGAGCTCACAGGCAGGTGATGTAGCAGATCCTGTGGTTCCACAGACTACACAGGCCAGCTCGTTGCCACTTTTGGAAACTGGGTCGTCATCTTCACAAGCTGAAAATGCAGATAGCAGAACTACAGATACAAAAGAAATACAAGCTGCAACATCAGACAGTTCACAGAACTCCTCCGAGGAGCTTGAACGCTCTCCTGAAAAAGCCAAGCTGAAAAAGAACCGTTGCTTTATGTGCCGTAAAAAGATTGGACTCACTGGGTTCGAATGTCGATGTGGAAACGTATTCTGCGGGACTCACCGTTATTCTGATGTGCACAGTTGCTCTTATGACTACAAAGCGGATGCAGCTGAGAAGATCAGGAAAGAAAATCCAGTTGTGGTTGGAGAAAAGATTCAGAAGATATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGNCAATCCAGCTGATATCCCCTATTAGTGAGTCGTATTACATGGGTCATAGCTGTTTTCTGGCAGCTCTGGCCTGTGNAAAAAATACACAAAAAAAATATAAAAAAAAAAAAAAAAGNNNNGN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTATGGCGCAGGAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829048
dbEST ID: 79646750
Trimmed Sequence: TATCTTCTGAATCTTTTCTCCAACCACAACTGGATTTTCTTTCCTGATCTTCTCAGCTGCATCCGCTTTGTAGTCATAAGAGCAACTGTGCACATCAGAATAACGGTGAGTCCCGCAGAATACGTTTCCACATCGACATTCGAACCCAGTGAGTCCAATCTTTTTACGGCACATAAAGCAACGGTTCTTTTTCAGCTTGGCTTTTTCAGGAGAGCGTTCAAGCTCCTCGGAGGAGTTCTGTGAACTGTCTGATGTTGCAGCTTGTATTTCTTTTGTATCTGTAGTTCTGCTATCTGCATTTTCAGCTTGTGAAGATGACGACCCAGTTTCCAAAAGTGGCAACGAGCTGGCCTGTGTAGTCTGTGGAACCACAGGATCTGCTACATCACCTGCCTGTGAGCTCTCTGCATTCTGTGGGGTTGATGCCTCCACTCCACTTCCTACCGACACAACTGGAGGACTATTTCTCCCACCACTGTTGTTTTGCCTCTGTAGATGCTCTTTATAGCACACGGAACAGAGACCATTCGTTCGAGGATTACCGTAGAAGCCACAACCTGTTGAACATAGTAGTGGTGCTTGGCTGTGGTTTGTCTCCTGCGCCATAATCATGG
Full Trace Sequence: CCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATCTTCTGAATCTTTTCTCCAACCACAACTGGATTTTCTTTCCTGATCTTCTCAGCTGCATCCGCTTTGTAGTCATAAGAGCAACTGTGCACATCAGAATAACGGTGAGTCCCGCAGAATACGTTTCCACATCGACATTCGAACCCAGTGAGTCCAATCTTTTTACGGCACATAAAGCAACGGTTCTTTTTCAGCTTGGCTTTTTCAGGAGAGCGTTCAAGCTCCTCGGAGGAGTTCTGTGAACTGTCTGATGTTGCAGCTTGTATTTCTTTTGTATCTGTAGTTCTGCTATCTGCATTTTCAGCTTGTGAAGATGACGACCCAGTTTCCAAAAGTGGCAACGAGCTGGCCTGTGTAGTCTGTGGAACCACAGGATCTGCTACATCACCTGCCTGTGAGCTCTCTGCATTCTGTGGGGTTGATGCCTCCACTCCACTTCCTACCGACACAACTGGAGGACTATTTCTCCCACCACTGTTGTTTTGCCTCTGTAGATGCTCTTTATAGCACACGGAACAGAGACCATTCGTTCGAGGATTACCGTAGAAGCCACAACCTGTTGAACATAGTAGTGGTGCTTGGCTGTGGTTTGTCTCCTGCGCCATAATCATGGTGCCCACTTTATTGTACAAAGTTGGCATTATAAAAAACATTGCTCATCAATTTGTTTGCAACAACAAGGTCATTATCAGTCAAAATAAAAATCATTTATTTGGGGCCGAACTTAGAATGGCCGTAATACCACCCCTACCCCGGTCGGCGTGGGGAGGGGGGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATCTTCTGAATCTTTTCTCCAAC