ORFeome > zfpl1 ORF1 – XORFeome v1.0

zfpl1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: zfpl1
Gene ID: 991969
Gene Page ID: 991965
ORF Xenbase ID: 17305695

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129691
Original XGC clone length: 963

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ838614
dbEST ID: 79656316
Trimmed Sequence: ATGGGGCTGTGCAAATGTCCCAAGAGGAAAGTGACCAATTTATTCTGCTTTGAGCACCGTGTTAATGTTTGTGAACACTGCCTGGTGGCCAACCACGCTAAGTGCATTGTCCAGTCATACCTCCAGTGGCTTCAGGACAGTGATTACAACCCAAACTGTCGCCTGTGTAACACACTTCTCTCCTCCAAGGAAACTGCACGTCTAGTTTGTTACGATTTATTTCACTGGTCCTGCCTAAATGACCTGGCAACGCAACAGCCTCCAAATACAGCACCTGCCGGTTACCGTTGTCCAAGCTGCCAGGGACCTGTTTTTCCCCCTAACAATTTAGTTAGCCCAGTGGCTGCAACCCTTCGAGAGAAGCTCTCTACTGTCAACTGGGCCAGGGCTGGCCTTGGTCTTCCTTTGATTGAAGTAGCAGAGCCTGTAGATGATACAATGTCACACGATGAAACCGATTACAGGGACTGGTCGGTTGTTAATTCATCCAGTGATAACTTGTCAGAAACCCCAGAAACAACATCGCAGACTGGCTATACTTACAACTCTGTGGCCCCTGGTGCTGTACAAAGAATTTGAATGGAAACATGTCACAGGACCACGCTGTTAACAATCAGGGACCCCGGATCTGAAAACGTTCCCCTTATTGCAACCATCCATTCCCCCGAAAATTGTATGAAACCGCGAAAAAAAGGCCCAAAGCCCAAAATGCCTGTGAATTTACTTCAAATAATTAATAATTCCAGAAAAGGAAACCCAACCCCTCCACTGGGCC
Full Trace Sequence: CTCGAGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGCTGTGCAAATGTCCCAAGAGGAAAGTGACCAATTTATTCTGCTTTGAGCACCGTGTTAATGTTTGTGAACACTGCCTGGTGGCCAACCACGCTAAGTGCATTGTCCAGTCATACCTCCAGTGGCTTCAGGACAGTGATTACAACCCAAACTGTCGCCTGTGTAACACACTTCTCTCCTCCAAGGAAACTGCACGTCTAGTTTGTTACGATTTATTTCACTGGTCCTGCCTAAATGACCTGGCAACGCAACAGCCTCCAAATACAGCACCTGCCGGTTACCGTTGTCCAAGCTGCCAGGGACCTGTTTTTCCCCCTAACAATTTAGTTAGCCCAGTGGCTGCAACCCTTCGAGAGAAGCTCTCTACTGTCAACTGGGCCAGGGCTGGCCTTGGTCTTCCTTTGATTGAAGTAGCAGAGCCTGTAGATGATACAATGTCACACGATGAAACCGATTACAGGGACTGGTCGGTTGTTAATTCATCCAGTGATAACTTGTCAGAAACCCCAGAAACAACATCGCAGACTGGCTATACTTACAACTCTGTGGCCCCTGGTGCTGTACAAAGAATTTGAATGGAAACATGTCACAGGACCACGCTGTTAACAATCAGGGACCCCGGATCTGAAAACGTTCCCCTTATTGCAACCATCCATTCCCCCGAAAATTGTATGAAACCGCGAAAAAAAGGCCCAAAGCCCAAAATGCCTGTGAATTTACTTCAAATAATTAATAATTCCAGAAAAGGAAACCCAACCCCTCCACTGGGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGCTGTGCAAATGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838613
dbEST ID: 79656315
Trimmed Sequence: CTCCTTACCAACGTGAATATGAGGGTTCAAGAGAGGATCAAGATTTGGGTCATTATCAGCTGAAGCTCTGCCAAGTTTAGACATAAGTAGAATTAAGGTTAGGAACCCAAGGACACCAATAATCAGAATAACCAGAAAGCGCTGCATGCTGGAGGCTGGCCGGGACTTTGAACCAGATCGGTTCCGGAGTATCCTTGCCAGCCAGTTGAGCGTAGGTCTCCTTCTGTACTTATCATCATCGAAGTCAATCACAGCATCTTGGCCTCTGGCATTCTCTCGCGTGTCATACACTTTCCGGGGACTGGATGCTGCATTAAAGGGAACGCTTTCAGATCCGGTGTCCCTGATAGTAACAGCGTGGTCCTGTGACATGTTTCCATTCAAACTCTGTTGTACAGCACCAGGGGCCACAGAGTTGTATGTATAGCCAGTCTGCGATGTTGTTTCTGGGGTTTCTGACAAGTTATCACTGGATGAATTAACAACCGACCAGTCCCTGTAATCGGTTTCATCGTGTGACATTGTATCATCTACAGGCTCTGCTACTTCAATCAAAGGAAGACCAGGGCCGCCCTGGGCCAGTTGACAGTAGAGAGCTTCTCTCGAAAGGTTGCAGCCACTGGGCTAACTAAATTGGTAGGGGGAAAGAAAAGGTCCCCTGGCACCTTGGAACAACGTAACCCGCAGGTGCTGTTATTTGGAGGGCGGTTGCCTTTGCCCGGTCCTTTAAGGCCGGGACCAGTGAAAAGGAGTCCTAAACAAAAAAAA
Full Trace Sequence: GGGAATCTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCCTTACCAACGTGAATATGAGGGTTCAAGAGAGGATCAAGATTTGGGTCATTATCAGCTGAAGCTCTGCCAAGTTTAGACATAAGTAGAATTAAGGTTAGGAACCCAAGGACACCAATAATCAGAATAACCAGAAAGCGCTGCATGCTGGAGGCTGGCCGGGACTTTGAACCAGATCGGTTCCGGAGTATCCTTGCCAGCCAGTTGAGCGTAGGTCTCCTTCTGTACTTATCATCATCGAAGTCAATCACAGCATCTTGGCCTCTGGCATTCTCTCGCGTGTCATACACTTTCCGGGGACTGGATGCTGCATTAAAGGGAACGCTTTCAGATCCGGTGTCCCTGATAGTAACAGCGTGGTCCTGTGACATGTTTCCATTCAAACTCTGTTGTACAGCACCAGGGGCCACAGAGTTGTATGTATAGCCAGTCTGCGATGTTGTTTCTGGGGTTTCTGACAAGTTATCACTGGATGAATTAACAACCGACCAGTCCCTGTAATCGGTTTCATCGTGTGACATTGTATCATCTACAGGCTCTGCTACTTCAATCAAAGGAAGACCAGGGCCGCCCTGGGCCAGTTGACAGTAGAGAGCTTCTCTCGAAAGGTTGCAGCCACTGGGCTAACTAAATTGGTAGGGGGAAAGAAAAGGTCCCCTGGCACCTTGGAACAACGTAACCCGCAGGTGCTGTTATTTGGAGGGCGGTTGCCTTTGCCCGGTCCTTTAAGGCCGGGACCAGTGAAAAGGAGTCCTAAACAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCTTACCAACGTGAATATG