ORFeome > zmat5 ORF1 – XORFeome v1.0

zmat5 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: zmat5
Gene ID: 984929
Gene Page ID: 984923
ORF Xenbase ID: 17305779

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078573
Original XGC clone length: 198

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ839614
dbEST ID: 79657316
Trimmed Sequence: ATGGGGAGGCGATATTTCTGCGACTACTGCGATCGCTCTTTTCAGGACAATTTACACAACCGCAAGAAGCACCTGAATGGCGTGCAGCACCAGCGGAGCAAAAAGGCCTGGTTTGATACGTTCAGAGATGCTTCGGAGGTCCTTGCAAAAGAACAAACCAAGAAACTTTGCAGGAGATTTATACAGTGGTCAGTGTT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGAGGCGATATTTCTGCGACTACTGCGATCGCTCTTTTCAGGACAATTTACACAACCGCAAGAAGCACCTGAATGGCGTGCAGCACCAGCGGAGCAAAAAGGCCTGGTTTGATACGTTCAGAGATGCTTCGGAGGTCCTTGCAAAAGAACAAACCAAGAAACTTTGCAGGAGATTTATACAGTGGTCAGTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACCGATATCCCCTATAGTGAGTCATATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAAAAAAAAAAGAAACAGAATATACAAGAGCCCAGAAACCCCACCGGGACCAAGGAGGCACACAATCTCCCCAGGAAAGGGGCGCCGGGATCTCCCCGCTGTAAAAGGGGGCAGGGCCAACCCAACGCCAAAAACCCGGAGGAGGGGTATAACCTTGGGGAAAAAACGCGGGGGGGGCCCCACCGCGGAAAAGAGAAAAAACAAACGCGCGGAGGGCGGGGGGACGGGAACTTTTAACGGAATTAAGGGGGGGTTTTTGGGGGAATTGGTGGTTTTCCGGCGATGAACAAAAAGGGTTTTTGGGGGGAAGAGTTGTGGTTCTGAGACACCAAAAAAAAAAACCCCCGTTGACCCGGGGGTTATATATTTTAGAAGTATGGGGGAAAGGCCCGGAAAGAGTAAAAACAAAGCCGCCCAAAACCCCACGGCTTAAGCCGACGGGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAGGCGATATTTCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839613
dbEST ID: 79657315
Trimmed Sequence: CACTGACCACTGTATAAATCTCCTGCAAAGTTTCTTGGTTTGTTCTTCTGCAAGGACCTCCGAAGCATCTCTGAACGTATCAAACCAGGCCTTTTTGCTCCGCTGGTGCTGCACGCCATTCAGGTGCTTCTTGCGGTTGTGTAAATTGTCCTGAAAAGAGCGATCGCAGTAGTCGCAGAAATATCGCCTCCCCATGG
Full Trace Sequence: AAAACGTCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTNCNACNAATTNATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAANTTGGCAACACTGACCACTGTATAAATCTCCTGCAAAGTTTCTTGGTTTGTTCTTCTGCAAGGACCTCCGAAGCATCTCTGAACGTATCAAACCAGGCCTTTTTGCTCCGCTGGTGCTGCACGCCATTCAGGTGCTTCTTGCGGTTGTGTAAATTGTCCTGAAAAGAGCGATCGCAGTAGTCGCAGAAATATCGCCTCCCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGTCCAACCTTAATACTGGCCATCGTTTTACAAAAACAAAACAGAGAAATTAAAAAAAACCCCTTGGCAACGTTGGGCACGAAAAAAGCAAAGGTCCATCGCTAAAATGGGCCCACGGGTACTCCTGGTAAAGGCGGCAAGAGCCCTCAAACGGAGGACCCGAGCGAGTCCTGTTCGGATTTTAAAAACTCGGCGGGGAGCGGATCTCCACCGTGCAAAACCATTAAACAAAACGGGGGGGGTTCGGGAACGGTGGCGTTAGGCTGTTTTTATAAAATTGTTTTGGTGGTATTACAACGGCGCGGGCCCACCAAAACAAAAGGGAAACCGCCGGTGGCGGGTGGATATTTANTAAAAAAACAACAAACCCCAAAGGCGCGGCCGGCTCGCACAAAAAAAAAAAAAAAAAAAAAGGAGAGGAGGGGGGGGGAAAGAANNCCCAAAAAACACGGAGAGTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTGACCACTGTATAAATCTCCT