ORFeome > znf238.2 ORF1 – XORFeome v1.0

znf238.2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: znf238.2
Gene ID: 1219070
Gene Page ID: 1219065
ORF Xenbase ID: 17305839

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC046572
Original XGC clone length: 1506

Human orthology & disease relationships

NCBI Entrez ID: 10472
Ensembl gene IDs: ENSG00000179456
Directly associated (OMIM) disease MIM numbers: 612337
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11017
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: JZ824367
dbEST ID: 79642069
Trimmed Sequence: ATGAAGCCGCAGGATTCCCACAAACTCTGGGCACTGAAGCAGCCGGCGGCTCCCGGGGCCCCCAGCGCAGCCTGTTATGAAGGAAGAATGGAGTTTCCAGACCATAGCCGCCAGTTGCTGCAGTGTCTGAGTCAGCAGCGTCACCAGGGCTTCCTGTGTGACTGTACTGTTTTAGTTGGAGAAGCACAATTCCGAGCCCACAGAGCAGTACTGGCTTCGTGCAGCATGTACTTCCATCTTTTCTACAGGGACCAGCTAGACAAAAGGGATATTGTGCATCTCAACAGTGACATTGTCACAGCCCCAGCATTCAGCCTTCTGCTTCAATTCATGTATGAAGGGAAGCTCGAGTTCAGCAATCTCCCAGTCGAAGATGTGTTGGCTGCAGCAAGCTACCTTCACATGTATGACATTGTCAAAGTCTGCAAGGGCAAGTTAAAAGATAAAGAACTTAATTCGGGAGAAAAGATCATAGACGACGGGGAAAAAGACGACAAGCCGGTAGACTCTGAGGAACATCATGAACACAGCTTCGATGCAAGTCAACAAAAAATCTCCACCCTCGACAGTGTAAAACCAATTTGGAAGGAGAAGGTCAGTGGACTTTCTGGGCTATCCTCTGACTTGATAGGTGTCNATTCAGTTCCAGCAGAGGCTGTTATGTGGTAGAGAGCAGCTGGGAAAACAAAGGCAATGGCAGTAGTCCCTCCAAGCCTTTGTTCCCCAAAGGTCTCTAACCCCCACATTCTCCAAGTG
Full Trace Sequence: ATTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGCCGCAGGATTCCCACAAACTCTGGGCACTGAAGCAGCCGGCGGCTCCCGGGGCCCCCAGCGCAGCCTGTTATGAAGGAAGAATGGAGTTTCCAGACCATAGCCGCCAGTTGCTGCAGTGTCTGAGTCAGCAGCGTCACCAGGGCTTCCTGTGTGACTGTACTGTTTTAGTTGGAGAAGCACAATTCCGAGCCCACAGAGCAGTACTGGCTTCGTGCAGCATGTACTTCCATCTTTTCTACAGGGACCAGCTAGACAAAAGGGATATTGTGCATCTCAACAGTGACATTGTCACAGCCCCAGCATTCAGCCTTCTGCTTCAATTCATGTATGAAGGGAAGCTCGAGTTCAGCAATCTCCCAGTCGAAGATGTGTTGGCTGCAGCAAGCTACCTTCACATGTATGACATTGTCAAAGTCTGCAAGGGCAAGTTAAAAGATAAAGAACTTAATTCGGGAGAAAAGATCATAGACGACGGGGAAAAAGACGACAAGCCGGTAGACTCTGAGGAACATCATGAACACAGCTTCGATGCAAGTCAACAAAAAATCTCCACCCTCGACAGTGTAAAACCAATTTGGAAGGAGAAGGTCAGTGGACTTTCTGGGCTATCCTCTGACTTGATAGGTGTCNATTCAGTTCCAGCAGAGGCTGTTATGTGGTAGAGAGCAGCTGGGAAAACAAAGGCAATGGCAGTAGTCCCTCCAAGCCTTTGTTCCCCAAAGGTCTCTAACCCCCACATTCTCCAAGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGCCGCAGGATTCCCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829726
dbEST ID: 79647428
Trimmed Sequence: CACAACCAATGACTTTACCAGGCCACAGTGAAACTTACGAATGTGTCTGTATAAATCCCCTGACTGAGTGAAACGTCTCTCACACCATTTGCACGCATGCGGTTTCTCCCTGGTGTGAACCACGGCATGTCGGCTTAAATTATGGGAATACTGAAAACTCTTCCCACACTGTCCACAGGTGAAAGGTTTTTCACCCGAGTGAGTGCGCTCGTGTCTCTTTAAGGTGTACATACATGAAAAGGTTTTGCCACATATGGTGCACGTGGGCACTGAGCCATCAGGAGACATCTTGATCCGTGAATTGTCCTTGTCCTTGAAGTGTGAGCTCAGGTGCAGCTGCAAAATGTGGGGACTGGGAAACACCTTACTACAAAGGGGACATATGCAAATTTGTCCAGGAGACACCAGCACACCTGATGTGGAAAGATCAGAGGAGTCCATTTCATCCTCGCTTTCATCTCGATCTTGATACAAGTCATCTTCCCTAGTGTGAGAATTGCCATTTCCTGTGAACATGTGTCCTAACCCGGTCACTAGACTTTTGGCTGGATTCCCAACTTGTTGACTTTTTGGACTCTTTGCTTGACTGTCCTCCTGTTCTGACAGCAAGTCTTGCTCATGTTTAACAAGTGGCAAAGAGCCCTGCTGCTGGCTGTCGGAGACCAGCTGGTCCAAAACATAGGAAAGGGGGTGGGAAGGAAATTCCTCCCAAGGCATAAGGCTTTGAAAAGAAAAAATCCCAAAAAGCGCCC
Full Trace Sequence: CGGCGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACAACCAATGACTTTACCAGGCCACAGTGAAACTTACGAATGTGTCTGTATAAATCCCCTGACTGAGTGAAACGTCTCTCACACCATTTGCACGCATGCGGTTTCTCCCTGGTGTGAACCACGGCATGTCGGCTTAAATTATGGGAATACTGAAAACTCTTCCCACACTGTCCACAGGTGAAAGGTTTTTCACCCGAGTGAGTGCGCTCGTGTCTCTTTAAGGTGTACATACATGAAAAGGTTTTGCCACATATGGTGCACGTGGGCACTGAGCCATCAGGAGACATCTTGATCCGTGAATTGTCCTTGTCCTTGAAGTGTGAGCTCAGGTGCAGCTGCAAAATGTGGGGACTGGGAAACACCTTACTACAAAGGGGACATATGCAAATTTGTCCAGGAGACACCAGCACACCTGATGTGGAAAGATCAGAGGAGTCCATTTCATCCTCGCTTTCATCTCGATCTTGATACAAGTCATCTTCCCTAGTGTGAGAATTGCCATTTCCTGTGAACATGTGTCCTAACCCGGTCACTAGACTTTTGGCTGGATTCCCAACTTGTTGACTTTTTGGACTCTTTGCTTGACTGTCCTCCTGTTCTGACAGCAAGTCTTGCTCATGTTTAACAAGTGGCAAAGAGCCCTGCTGCTGGCTGTCGGAGACCAGCTGGTCCAAAACATAGGAAAGGGGGTGGGAAGGAAATTCCTCCCAAGGCATAAGGCTTTGAAAAGAAAAAATCCCAAAAAGCGCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACAACCAATGACTTTACCAG