ORFeome > znf276 ORF1 – XORFeome v1.0

znf276 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: znf276
Gene ID: 983672
Gene Page ID: 983668
ORF Xenbase ID: 17305857

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126056
Original XGC clone length: 1713

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ837763
dbEST ID: 79655465
Trimmed Sequence: ATGAAGCGAGACAGACGTAGGGGGCGTGCGGCTTCGGAGCGGAAGAAAAGAGTTCGGGTGGCGGCGCCTGAAGGGATTAGACCTGTGGGCTGCAACGTGCAATTGGGCCGAGAGGAGCGGATCCAGGGCATTGGCAAGACTCAGAGCAGTGGCTACTGCCGTCTCTGTCACGGTAAGTTCTCCTCTCGTAGCCTGCGCCATGCTTTTGGGAAAGTGCCAGTGACAGGTCTGAGCTCAGAGAAGCAGAAACGCCTGGACCATGTGTTCTTTGCTGACTTCCATCAGCTGCTGGGGGTGTCTGTGCTCCAGGAACCTGAGCTGCCTCAGTTTGTGTGCAAGCACTGCCATGCTCAGTTCTACAAATGTCGAAGTTTGCTGAGGACTTTCATTCACAGAGTGAACACGTCGCCTACCAAACCTCATGGCAACAAATCTGACAAAATGCATGTCATCAGTTCTACCACAGGTCCCTGTACAGATTTAATAACCTCAGCTGCAGAATGTCTACACAGCCTGGTGAGCTGGACACACAAACATGCAAGAGGCTGCTCCTTCCTACCTATACAACAGAGGGTGGTGTCCGCGCACTACTGTGGTATTGTACGAGTATTGTGGGAATGCGACGGGGGTCATTGACTTATCATGGAACCAGAGTCCGATTGCTTCTCTTTCTTTTCTCCACCCCGAAAGAAATGGACCTCGTACCAAAGTTTAATTGGCGGGTGGAGGGCCCC
Full Trace Sequence: CGCGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGCGAGACAGACGTAGGGGGCGTGCGGCTTCGGAGCGGAAGAAAAGAGTTCGGGTGGCGGCGCCTGAAGGGATTAGACCTGTGGGCTGCAACGTGCAATTGGGCCGAGAGGAGCGGATCCAGGGCATTGGCAAGACTCAGAGCAGTGGCTACTGCCGTCTCTGTCACGGTAAGTTCTCCTCTCGTAGCCTGCGCCATGCTTTTGGGAAAGTGCCAGTGACAGGTCTGAGCTCAGAGAAGCAGAAACGCCTGGACCATGTGTTCTTTGCTGACTTCCATCAGCTGCTGGGGGTGTCTGTGCTCCAGGAACCTGAGCTGCCTCAGTTTGTGTGCAAGCACTGCCATGCTCAGTTCTACAAATGTCGAAGTTTGCTGAGGACTTTCATTCACAGAGTGAACACGTCGCCTACCAAACCTCATGGCAACAAATCTGACAAAATGCATGTCATCAGTTCTACCACAGGTCCCTGTACAGATTTAATAACCTCAGCTGCAGAATGTCTACACAGCCTGGTGAGCTGGACACACAAACATGCAAGAGGCTGCTCCTTCCTACCTATACAACAGAGGGTGGTGTCCGCGCACTACTGTGGTATTGTACGAGTATTGTGGGAATGCGACGGGGGTCATTGACTTATCATGGAACCAGAGTCCGATTGCTTCTCTTTCTTTTCTCCACCCCGAAAGAAATGGACCTCGTACCAAAGTTTAATTGGCGGGTGGAGGGCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGCGAGACAGACGTA

Sequences - 3ʹ (reverse) EST

Accession: JZ837762
dbEST ID: 79655464
Trimmed Sequence: GGGTGGGGGCTGCTGCGTCCGTTCCGGTTTCAATATTTGTTCTTCTGTTGTCCCAGAGTGGGCGTCTGGTTCTGTTTCTGGCTGCTTGGCTGGGCTCTGTGTGAGTGGATGGACCATAGACATGTGTACATTGAGATTATGGGCCTTCTCAAAGCGTTTCGCACATTGGTCACAGGCAAACTCCAAATCTGCCTCAGCTTTGTGCTTGGTCATGTGGTACTTTAGCGATGCTCTCTGCCTGCACTGGAAGCCACATACTTCACACTGTAAAGGTTTTGCACCAGAGTGTCTCATCTGATGCACAGAAAGGTGCTTCCGTTGCTTGAAAGCTTGTCCACACTGGTCACAGATGTGGTTTCTCTCTTCTGTGTGAATAAGCTTGACATGCCTCTGTAAGTACCGATCTATCATGAATACTTTGTTGCAGCCTGGATGTGGACATGGTCGCTCCCGCACCTCCTCATGATGTTCCTTAATGTGTTTCTTCATACCGTCAGCACCTCTGTATACAGCTGTGCAGCCTTGGTATGGACACTTATAAATTGTAGGCAGTTCCTCCCGTTCCCGTTTAATTTTCTTCCAGCCTGGTTTAGGACCTGGCTTCTTTTTCTCTTTGAATTCTGCCGGCTTTTGGGACTTTCTAGGTTCTCTTTTCTTTTTAATGATCCGCTTTTCTATGCATGGTTCAGAGGAGTCATCTGAGGACGGCTGCTGTCCGGGTTCTTCCCCTTCCTTCTCGTTCTTGAAGTCTCCGTCTAAGTGTTGCTTCGGGGCTGGTTTAAAAAATCTTTGGAAACAAAATTAAACTTCCGCGGTCGTCGCCTTTTTATTGATCTGGGGCAAGCAAGGGTGGGAAAATGGGGGGTGGTTTGTGCCGGTTTAATTTTAAAAATATATCTCTTCCAGAGAGGGAGGAGGGGGGTTTTAAAAAGGGGGGGAAAGAAAGGAAACGGTGGGAGGGAGAAAATTCCCTTCGAGTTTAGTTTTTTTTTTTTTGAAATTAACGTATTAAAACTTTAGAATAAAAAAAAATAATAACAATTATTATATCTCTTCTCGCATACGAAAGGAGAAGAAAAAAAAAAGAGAAAAGAATGGTGTCTCGTGTATTTTTAGTGGTGTTTATATGGTGGGTGACCGGGGAAATACCCCCACCGCGCGGCGCCCGCCGGTGC
Full Trace Sequence: GGCAGGGTAACAGCCATTGAACATTGTACAAACGAACCACTAATAGGGGAAGACCAGCCTGGAAGGCAAATAATGATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGTGGGGGCTGCTGCGTCCGTTCCGGTTTCAATATTTGTTCTTCTGTTGTCCCAGAGTGGGCGTCTGGTTCTGTTTCTGGCTGCTTGGCTGGGCTCTGTGTGAGTGGATGGACCATAGACATGTGTACATTGAGATTATGGGCCTTCTCAAAGCGTTTCGCACATTGGTCACAGGCAAACTCCAAATCTGCCTCAGCTTTGTGCTTGGTCATGTGGTACTTTAGCGATGCTCTCTGCCTGCACTGGAAGCCACATACTTCACACTGTAAAGGTTTTGCACCAGAGTGTCTCATCTGATGCACAGAAAGGTGCTTCCGTTGCTTGAAAGCTTGTCCACACTGGTCACAGATGTGGTTTCTCTCTTCTGTGTGAATAAGCTTGACATGCCTCTGTAAGTACCGATCTATCATGAATACTTTGTTGCAGCCTGGATGTGGACATGGTCGCTCCCGCACCTCCTCATGATGTTCCTTAATGTGTTTCTTCATACCGTCAGCACCTCTGTATACAGCTGTGCAGCCTTGGTATGGACACTTATAAATTGTAGGCAGTTCCTCCCGTTCCCGTTTAATTTTCTTCCAGCCTGGTTTAGGACCTGGCTTCTTTTTCTCTTTGAATTCTGCCGGCTTTTGGGACTTTCTAGGTTCTCTTTTCTTTTTAATGATCCGCTTTTCTATGCATGGTTCAGAGGAGTCATCTGAGGACGGCTGCTGTCCGGGTTCTTCCCCTTCCTTCTCGTTCTTGAAGTCTCCGTCTAAGTGTTGCTTCGGGGCTGGTTTAAAAAATCTTTGGAAACAAAATTAAACTTCCGCGGTCGTCGCCTTTTTATTGATCTGGGGCAAGCAAGGGTGGGAAAATGGGGGGTGGTTTGTGCCGGTTTAATTTTAAAAATATATCTCTTCCAGAGAGGGAGGAGGGGGGTTTTAAAAAGGGGGGGAAAGAAAGGAAACGGTGGGAGGGAGAAAATTCCCTTCGAGTTTAGTTTTTTTTTTTTTGAAATTAACGTATTAAAACTTTAGAATAAAAAAAAATAATAACAATTATTATATCTCTTCTCGCATACGAAAGGAGAAGAAAAAAAAAAGAGAAAAGAATGGTGTCTCGTGTATTTTTAGTGGTGTTTATATGGTGGGTGACCGGGGAAATACCCCCACCGCGCGGCGCCCGCCGGTGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGTGGGGGCTGCTGCGT