ORFeome > znf346 ORF1 – XORFeome v1.0

znf346 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: znf346
Gene ID: 967548
Gene Page ID: 967543
ORF Xenbase ID: 17305887

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041713
Original XGC clone length: 1575

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11009
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ823712
dbEST ID: 79641414
Trimmed Sequence: ATGGCGGACGAGTTCGGTAACGGGGACGCGTTGGATTTGCCAGTGGGAAAGGACGCAGTTAATTCTTTGATCCGGGAGAACAGTCATATATTTTCAGACACCCAGTGTAAAGTATGCAGTGCAGTGCTAATTTCGGAATCTCAAAAGCTTGCACACTACCAGAGCCGGAAACATGCAAATAAAGTACGCCGCTATATGGCGATAAACCAGGGGGAGGACTCCGTTCCTGCAAAAAAGTTTAAAGCAGCGCCTGCTGAGATCAGCGATGGAGAAGACAGAAGCAAGTGCTGTCCCGTATGCAACATGACATTCTCTTCCCCGGTTGTCGCTGAATCCCATTACATCGGAAAAACACACATCAAAAATTTAAGGCTGCGGGAGCAAGGAGGAGTAAAGGAAGGTATGGTGAACCAAGCAAAAAAACCCCCCCCCCCACCGGTACCACCAAAAATGGATAATAAAAGGAATCATCCGAATCTGGCAAAGTCCGGTAGCTCCGGCCCTTCCCCTTTAAAAACCCCCTAATGGGCAAACCACCTTTACCCAGGAAGAAACCCCAGAAACCAGGAAACCAAACCCCGAATCTGGATTATTTCCCCCACTCCTGGGCAACGGCCACCCCAACTTCTCATCCTTCGAATTTAAACTCCTCCATTGCCAGGCTCAGGATCCACTGGGGAAAGGTTTTTCATGTGACCAGTGTTACAATGGGGCTGAATTTCAATTGAACAGTATCAAGCCCCATGTTCAACGGACCTAAACCCAAGGAATCA
Full Trace Sequence: GACAGTAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGACGAGTTCGGTAACGGGGACGCGTTGGATTTGCCAGTGGGAAAGGACGCAGTTAATTCTTTGATCCGGGAGAACAGTCATATATTTTCAGACACCCAGTGTAAAGTATGCAGTGCAGTGCTAATTTCGGAATCTCAAAAGCTTGCACACTACCAGAGCCGGAAACATGCAAATAAAGTACGCCGCTATATGGCGATAAACCAGGGGGAGGACTCCGTTCCTGCAAAAAAGTTTAAAGCAGCGCCTGCTGAGATCAGCGATGGAGAAGACAGAAGCAAGTGCTGTCCCGTATGCAACATGACATTCTCTTCCCCGGTTGTCGCTGAATCCCATTACATCGGAAAAACACACATCAAAAATTTAAGGCTGCGGGAGCAAGGAGGAGTAAAGGAAGGTATGGTGAACCAAGCAAAAAAACCCCCCCCCCCACCGGTACCACCAAAAATGGATAATAAAAGGAATCATCCGAATCTGGCAAAGTCCGGTAGCTCCGGCCCTTCCCCTTTAAAAACCCCCTAATGGGCAAACCACCTTTACCCAGGAAGAAACCCCAGAAACCAGGAAACCAAACCCCGAATCTGGATTATTTCCCCCACTCCTGGGCAACGGCCACCCCAACTTCTCATCCTTCGAATTTAAACTCCTCCATTGCCAGGCTCAGGATCCACTGGGGAAAGGTTTTTCATGTGACCAGTGTTACAATGGGGCTGAATTTCAATTGAACAGTATCAAGCCCCATGTTCAACGGACCTAAACCCAAGGAATCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGACGAGTTCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829022
dbEST ID: 79646724
Trimmed Sequence: CTCAAAGTCTTCATTAAAATAATTATATCCATCAGGACTCATCGTATCGTCATGGACATATGGCTGACTGCTGTGTGCAGGAGGGTAAAGAGGTGGCAATAAACTCCCCAAGGGAGGCAAACTGCCAAACGATGAAGGGCCTTTAGGTGTTAGATCTCCAGAAGGACAAAAACCTCTACCTGATGGTCCCCCTGATGACAGTGCCCCTCCTGCTGATAGAGGGCTTGCAAATGCTGAAGGGCCTACGGCTGACGGGAGACCTTCCTCAGACGATGGTGTCATGGACATTAATTGGTTCTTGTGTTTAGCCCCGCTGACATGGGCTTGATACTGCTCTATTGAATTCAGCACAATGTTACACGTGTCACATGAAAAACCTTTCCCAGCTGATCCTGATGCAAATGCTGAAGGGGCTACAGCTGCTGTGTGACCTTCCTCAGACAACGGTGTCATGGACATTAAATGATTCTTGTGTTTAGCTCCACTGATATGGGCTTGATACTGCTCTATTGAATTCAGCACAATGTTACACGTGTCACATGAAAAACCTTTCCCAGCTGATCCTGATGCAAATGCTGAGGGGGCTACAGCTGCTGTGTGACCTTCCTCAGACAACGGTGTCATGGACTTTAAATGGGTCTTGTGTTTAGCTCCACTGATATGGGGCTGATACTGCTCTATTGAATTCAGCACAATGGTACACGTGTCACATGAAAAACCTTTTCCCAGCTGAACCCTGATGCAAATTGGCCTGAAAGGG
Full Trace Sequence: GGCACTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCAAAGTCTTCATTAAAATAATTATATCCATCAGGACTCATCGTATCGTCATGGACATATGGCTGACTGCTGTGTGCAGGAGGGTAAAGAGGTGGCAATAAACTCCCCAAGGGAGGCAAACTGCCAAACGATGAAGGGCCTTTAGGTGTTAGATCTCCAGAAGGACAAAAACCTCTACCTGATGGTCCCCCTGATGACAGTGCCCCTCCTGCTGATAGAGGGCTTGCAAATGCTGAAGGGCCTACGGCTGACGGGAGACCTTCCTCAGACGATGGTGTCATGGACATTAATTGGTTCTTGTGTTTAGCCCCGCTGACATGGGCTTGATACTGCTCTATTGAATTCAGCACAATGTTACACGTGTCACATGAAAAACCTTTCCCAGCTGATCCTGATGCAAATGCTGAAGGGGCTACAGCTGCTGTGTGACCTTCCTCAGACAACGGTGTCATGGACATTAAATGATTCTTGTGTTTAGCTCCACTGATATGGGCTTGATACTGCTCTATTGAATTCAGCACAATGTTACACGTGTCACATGAAAAACCTTTCCCAGCTGATCCTGATGCAAATGCTGAGGGGGCTACAGCTGCTGTGTGACCTTCCTCAGACAACGGTGTCATGGACTTTAAATGGGTCTTGTGTTTAGCTCCACTGATATGGGGCTGATACTGCTCTATTGAATTCAGCACAATGGTACACGTGTCACATGAAAAACCTTTTCCCAGCTGAACCCTGATGCAAATTGGCCTGAAAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAAAGTCTTCATTAAAATAATT