ORFeome > znf41 ORF1 – XORFeome v1.0

znf41 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: znf41
Gene ID: 5909740
Gene Page ID: 5909738
ORF Xenbase ID: 17305911

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC106612
Original XGC clone length: 813

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ837721
dbEST ID: 79655423
Trimmed Sequence: ATGGCACAGGATAAACCAGGGGGCAGTAGCATTACATCTGAGGGTGCACCTAAAGAGAAACTAGAAATCAGTACCCCTCCTAATGACAAAGTATCCAAGCTAAATAAACGAGTAAAGCGCTTGAGCCAATGTGCAGTAGAGACTGCAGACAAAGTGACCTTGTGCCAAGGAGGGAATCTCATGCACTCAGACAGTTATACATTTACCACTCCGGCACAGTCAGCGCCCTTACCCTTTTATCCAGTGTTATATGTTATTAACAAGGGTATAGCAGTGCCAACTCCTGTAGGTAGCGAGATCCCATTGAGCTGCCCCGAGTGCCAGGCTTGTTTTGCCACCAGCACAGACCTCGGTGAACATCAGTGTATTCACAAACAAGATGAGTTGACATGTGCCGACTGCGGCAAATGTTTTGTCAATCGATCCAGATTTGTTAGACACCAGCGATACCACAAACCAGAGAAATTTATCATTTGTGTGGAATGCGGAAAGAGTTTTTGGCATAAATCGAACCTGACCGCGCACCAGCGAATCCACACAGGGGAGAAGCCCTTTACCTGTTCGGACTGTGGGAGATCTTTTGCTACAAATTCCCAAGTCCTTCGGCATCGGAGGATCCACACTGGGGGAGAGGCCTTTTGCTTGTCTAGAATGTGGCAAATGTATCACCAACCACTCTAATCTGGTGGAATCTCAAACCATTTCATACGGGGTTGAAACCCATTCCCTTTGTTCTTAAATGTGGGCAAAAATTTCAGAATCAAAAAAAATATCCTTTAATG
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCACAGGATAAACCAGGGGGCAGTAGCATTACATCTGAGGGTGCACCTAAAGAGAAACTAGAAATCAGTACCCCTCCTAATGACAAAGTATCCAAGCTAAATAAACGAGTAAAGCGCTTGAGCCAATGTGCAGTAGAGACTGCAGACAAAGTGACCTTGTGCCAAGGAGGGAATCTCATGCACTCAGACAGTTATACATTTACCACTCCGGCACAGTCAGCGCCCTTACCCTTTTATCCAGTGTTATATGTTATTAACAAGGGTATAGCAGTGCCAACTCCTGTAGGTAGCGAGATCCCATTGAGCTGCCCCGAGTGCCAGGCTTGTTTTGCCACCAGCACAGACCTCGGTGAACATCAGTGTATTCACAAACAAGATGAGTTGACATGTGCCGACTGCGGCAAATGTTTTGTCAATCGATCCAGATTTGTTAGACACCAGCGATACCACAAACCAGAGAAATTTATCATTTGTGTGGAATGCGGAAAGAGTTTTTGGCATAAATCGAACCTGACCGCGCACCAGCGAATCCACACAGGGGAGAAGCCCTTTACCTGTTCGGACTGTGGGAGATCTTTTGCTACAAATTCCCAAGTCCTTCGGCATCGGAGGATCCACACTGGGGGAGAGGCCTTTTGCTTGTCTAGAATGTGGCAAATGTATCACCAACCACTCTAATCTGGTGGAATCTCAAACCATTTCATACGGGGTTGAAACCCATTCCCTTTGTTCTTAAATGTGGGCAAAAATTTCAGAATCAAAAAAAATATCCTTTAATG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACAGGATAAACCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837720
dbEST ID: 79655422
Trimmed Sequence: TACTATGCCCGCTTTCACTGTGTGTGCCTGCAAGTGCCGATAAAGATATCTTTTCGATCTGAAATATTTGCCACATTCAGAACAAGCGAATGGCTTCACCCCTGTATGAATGGTTTGATGATCCACCAGATTAGAGCTGGTGGTGAAACATTTGCCACACTCTAGACAAGCAAAAGGCCTCTCCCCAGTGTGGATCCTCCGATGCCGAAGGACCTGGGAATTTGTAGCAAAAGATTTCCCACAGTCCGAACAGGTAAAGGGCTTCTCCCCTGTGTGGATTCGCTGGTGCGCGGTCAGGTTCGATTTATGCCAAAAACTCTTTCCGCATTCCACACAAATGATAAATTTCTCTGGTTTGTGGTATCGCTGGTGTCTAACAAATCTGGATCGATTGACAAAACATTTGCCGCAGTCGGCACATGTCAACTCATCTTGTTTGTGAATACACTGATGTTCACCGAGGTCTGTGCTGGTGGCAAAACAAGCCTGGCACTCGAGGCAGCTCAATGGGATCTCGCTACCTACAGGAGTTGGCACTGCTATACCCTTGTTAATAACATATAACACTGGAAAAAAAGGTAGGGGCGCTGACTGTGCCGGAGTGGTAAATGTAAAGCTGTCTTAGTTAATGAGATTCGCTCCTTGGCACGGGGTCAGTGGTGTTGCGGTCTCTACTGCACAGTGGCTCAGGCGCGTTACGTGGTTGGTGAGATGAGAAAGTTGGGTCGTAGGGAAGGGGACGGAGGGGAGGGTTCTCCTTAGGTGCACCCCCGGGAAGTAGGGGCGAATGCCCGGGTGGATTAAGCCTGTACCAGAGGGACGGAGGGTGGTGTGAAGAGTTTTGGATTGGAAAGAGAAAAATGGGGATGGGAATGGGGGGGAGGGGGGGAGGCGGGGGGAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAACAGAGAAAAAAACAACACCGACAGATTGGCGAAAACAGGAGAAGGTGGGGGGAGAGGAGGCGGGAAGGGGGGGGGGAGGGGGGGNCAAGAAGAGAGGGGGGAGNGAGGGGGGGGGAAAGGGGGGGGGGAGCGGGGGGAGGAAGGGGAGAGGGGGGGGGGGAGGAGGAGGGGNGGGGGGGGGAGGGGGGGGGGCAGAANGGGGGGGGGAGNAGAGACGGGANAGAGGGAGGAGGGGAGAGGGAGGAAGGGGGAGGGGNAAGAGAAAGGGGGGAGAAGAGAAGNGGGGGGAGNNAAGGANNGGGNAGAACGAGGGAGGAGGGANGAGNANANGA
Full Trace Sequence: GGGCGGGTAACAGCCACTGAAGATGGTAAAACGAACCACTATACGGGGAAGAAAGCCAGGAGGGCAAAAATGAGTATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACTATGCCCGCTTTCACTGTGTGTGCCTGCAAGTGCCGATAAAGATATCTTTTCGATCTGAAATATTTGCCACATTCAGAACAAGCGAATGGCTTCACCCCTGTATGAATGGTTTGATGATCCACCAGATTAGAGCTGGTGGTGAAACATTTGCCACACTCTAGACAAGCAAAAGGCCTCTCCCCAGTGTGGATCCTCCGATGCCGAAGGACCTGGGAATTTGTAGCAAAAGATTTCCCACAGTCCGAACAGGTAAAGGGCTTCTCCCCTGTGTGGATTCGCTGGTGCGCGGTCAGGTTCGATTTATGCCAAAAACTCTTTCCGCATTCCACACAAATGATAAATTTCTCTGGTTTGTGGTATCGCTGGTGTCTAACAAATCTGGATCGATTGACAAAACATTTGCCGCAGTCGGCACATGTCAACTCATCTTGTTTGTGAATACACTGATGTTCACCGAGGTCTGTGCTGGTGGCAAAACAAGCCTGGCACTCGAGGCAGCTCAATGGGATCTCGCTACCTACAGGAGTTGGCACTGCTATACCCTTGTTAATAACATATAACACTGGAAAAAAAGGTAGGGGCGCTGACTGTGCCGGAGTGGTAAATGTAAAGCTGTCTTAGTTAATGAGATTCGCTCCTTGGCACGGGGTCAGTGGTGTTGCGGTCTCTACTGCACAGTGGCTCAGGCGCGTTACGTGGTTGGTGAGATGAGAAAGTTGGGTCGTAGGGAAGGGGACGGAGGGGAGGGTTCTCCTTAGGTGCACCCCCGGGAAGTAGGGGCGAATGCCCGGGTGGATTAAGCCTGTACCAGAGGGACGGAGGGTGGTGTGAAGAGTTTTGGATTGGAAAGAGAAAAATGGGGATGGGAATGGGGGGGAGGGGGGGAGGCGGGGGGAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAACAGAGAAAAAAACAACACCGACAGATTGGCGAAAACAGGAGAAGGTGGGGGGAGAGGAGGCGGGAAGGGGGGGGGGAGGGGGGGNCAAGAAGAGAGGGGGGAGNGAGGGGGGGGGAAAGGGGGGGGGGAGCGGGGGGAGGAAGGGGAGAGGGGGGGGGGGAGGAGGAGGGGNGGGGGGGGGAGGGGGGGGGGCAGAANGGGGGGGGGAGNAGAGACGGGANAGAGGGAGGAGGGGAGAGGGAGGAAGGGGGAGGGGNAAGAGAAAGGGGGGAGAAGAGAAGNGGGGGGAGNNAAGGANNGGGNAGAACGAGGGAGGAGGGANGAGNANANGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACTATGCCCGCTTTCACT