ORFeome > znf703 ORF1 – XORFeome v1.0

znf703 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: znf703
Gene ID: 1217466
Gene Page ID: 1217459
ORF Xenbase ID: 17306025

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108592
Original XGC clone length: 1596

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ837934
dbEST ID: 79655636
Trimmed Sequence: ATGAACTGTTCTCCCCCTGGATCTTGCACAGACACAGAGCGACAGAGAAGCGGCACCCCGGCGACCCCCTGCGCCACTCTCGCACCCACTCACCCCCTGCGCCAGGCAAACCGACTGCCCATCCGGCGGATCAAAATGCTGACGGCGCACACAGGACACTTGCTGCACCCGGAGTACCTGCAGCCCCTCTCCTCCACCCCCATCAGCCCCATAGAGCTGGATGCCAAGAAAAACCCACTAGCTCTGCTGGCCCAGACCTGCTCACAGATAGGGAAGCCGGACCCCCCTCCGTCCTCTAAGCTGAATTCTGTGACCTCCAGCGAAAAGGAGAGTGGGCGCTCCTCTTCTTTGAAACTGGGAGAGTCTCCTTTGGAGGATAAGTCTAGCTTCAAACCGTACGCAAAGGGTGGGGAGACCAGGAAGGAAAGCGGATCATCTGCTGGTGGCGCTGCAGATAAGGCTGGATTTAGGGTGCCCAGTGGTTCTTGTCAGCCTTTTCCTCATGCCCCATCTCCGTCCTCAAGGGTGAGCTCTCCTGGACAGCACTGTGAGTCTAAAAATAACGAGAGCCAAGAGAAGAAAGAGCCTGAGGTAAACAAATCCAGCTTGGAGACCTCTCAAGCCAACCCTACTCTGACCAGGGGCAGTATTAGTAACTCCAGTGCCGAATCCAGCCAAAGCCGGGGATGTTGCCCCTACCACCAAATCTAACCCTCCCTTCCTTTGAATCAGGGCCACGTTGGCCCCCTAATTTCTCCCCTTAAAAACTGGGAACATTTCC
Full Trace Sequence: CCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACTGTTCTCCCCCTGGATCTTGCACAGACACAGAGCGACAGAGAAGCGGCACCCCGGCGACCCCCTGCGCCACTCTCGCACCCACTCACCCCCTGCGCCAGGCAAACCGACTGCCCATCCGGCGGATCAAAATGCTGACGGCGCACACAGGACACTTGCTGCACCCGGAGTACCTGCAGCCCCTCTCCTCCACCCCCATCAGCCCCATAGAGCTGGATGCCAAGAAAAACCCACTAGCTCTGCTGGCCCAGACCTGCTCACAGATAGGGAAGCCGGACCCCCCTCCGTCCTCTAAGCTGAATTCTGTGACCTCCAGCGAAAAGGAGAGTGGGCGCTCCTCTTCTTTGAAACTGGGAGAGTCTCCTTTGGAGGATAAGTCTAGCTTCAAACCGTACGCAAAGGGTGGGGAGACCAGGAAGGAAAGCGGATCATCTGCTGGTGGCGCTGCAGATAAGGCTGGATTTAGGGTGCCCAGTGGTTCTTGTCAGCCTTTTCCTCATGCCCCATCTCCGTCCTCAAGGGTGAGCTCTCCTGGACAGCACTGTGAGTCTAAAAATAACGAGAGCCAAGAGAAGAAAGAGCCTGAGGTAAACAAATCCAGCTTGGAGACCTCTCAAGCCAACCCTACTCTGACCAGGGGCAGTATTAGTAACTCCAGTGCCGAATCCAGCCAAAGCCGGGGATGTTGCCCCTACCACCAAATCTAACCCTCCCTTCCTTTGAATCAGGGCCACGTTGGCCCCCTAATTTCTCCCCTTAAAAACTGGGAACATTTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACTGTTCTCCCCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837933
dbEST ID: 79655635
Trimmed Sequence: CTGGTATCCTAGCGCTGAAGCTGATGTTAACCTCTGTCCATATAATGCGTATGGGGAGTAGTAGGATCCTGCTGGTAATGAGGGCACCGGGAGGCCATTTGGTGCCGTCAGGTGACCCTTTCCATATGGATGGTACCTACTTAGTCCAAAAGTATGTGGACTCCGTAAAGATAGAGACCCTGGCAATGTGTTAGGGCTTCCAGGCCCAGTAGGAGGAAGGTGTAGGTGACAGGAAGCAGCAGAACCCAAACCAGTAGGGTACCCAGCCAAAAGTTTGTCAGCTCCAGGCAAAGCTGTATGGGTCCTTAGGTGAGCAAGAAGTTCCTCTGAGGTGGCAAACCTTTTGTCACAAGGTCCACTGGCAGACACCCAGTTGCATATGTGGGGGACTGGGTCATTTTGGAGCATAAAGCCGTAGGTGTATAAAGGATGACCAGACAGTGATGGAGTGACGCTGGAAAACAAGGTGGTGTGCACTGAATGGAGGGGGTGACTGGGGGATACTAACAGGTAATCCGATTTCAAGGCACATGGGTTCTGGTCACAACTGGAAACATTGCTCCACCCAAAATGGCAAACTTTTTCGTAGCTCATGCAATAATGGATCCTTGCACAATCCCTTGCATAAATGAAGGGAGGTGAAACCCTCAGTGAAAAGCCCTGAAACCTGGGAAGGTTTACCCGGGGTAAAACCCTAAAATCCCACACCCAACCTAAATTCCCAAACAAAACGCTTTAATTTTGGAGTGTGGGTC
Full Trace Sequence: AACGGCCTATTGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGGTATCCTAGCGCTGAAGCTGATGTTAACCTCTGTCCATATAATGCGTATGGGGAGTAGTAGGATCCTGCTGGTAATGAGGGCACCGGGAGGCCATTTGGTGCCGTCAGGTGACCCTTTCCATATGGATGGTACCTACTTAGTCCAAAAGTATGTGGACTCCGTAAAGATAGAGACCCTGGCAATGTGTTAGGGCTTCCAGGCCCAGTAGGAGGAAGGTGTAGGTGACAGGAAGCAGCAGAACCCAAACCAGTAGGGTACCCAGCCAAAAGTTTGTCAGCTCCAGGCAAAGCTGTATGGGTCCTTAGGTGAGCAAGAAGTTCCTCTGAGGTGGCAAACCTTTTGTCACAAGGTCCACTGGCAGACACCCAGTTGCATATGTGGGGGACTGGGTCATTTTGGAGCATAAAGCCGTAGGTGTATAAAGGATGACCAGACAGTGATGGAGTGACGCTGGAAAACAAGGTGGTGTGCACTGAATGGAGGGGGTGACTGGGGGATACTAACAGGTAATCCGATTTCAAGGCACATGGGTTCTGGTCACAACTGGAAACATTGCTCCACCCAAAATGGCAAACTTTTTCGTAGCTCATGCAATAATGGATCCTTGCACAATCCCTTGCATAAATGAAGGGAGGTGAAACCCTCAGTGAAAAGCCCTGAAACCTGGGAAGGTTTACCCGGGGTAAAACCCTAAAATCCCACACCCAACCTAAATTCCCAAACAAAACGCTTTAATTTTGGAGTGTGGGTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGTATCCTAGCGCTGAA