ORFeome > znhit3 ORF1 – XORFeome v1.0

znhit3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: znhit3
Gene ID: 6254976
Gene Page ID: 5750414
ORF Xenbase ID: 17306073

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129774
Original XGC clone length: 438

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ838647
dbEST ID: 79656349
Trimmed Sequence: ATGCCTCTGCAGCCATGCTGTGTATGTTCTTCTGACACGCCGAAGTACCGATGTCCTGGCTGCCGAGCAAAATATTGCTCTGTTTCCTGTTGCAAGAAGCATAAAGAGGAATGCACTCTTTCATCAACTCCAGATACTGTTACCACACATATTGCCAGAGGAGAGAGATTGATGTCTAGAGAAGATGGTTTGATTGATGAAGATAATGAATCTGATAGAGTTCCTCCACACAAGCTGAAGCTTCTGGGGGAATCTGATGAGTTGAAGCATTTGCTTCTAAATCCGCATCTCAGAGAGCTTCTGATTAAGCTGGATCAGGCAGAAGAAAGAGAGGATGCAATGAAGAAATACATGCAAGAACCATTGTTTGTTGAATTTGCTGACAGATGCCTCAGCGTTGTAGAACCTGAAGAGAAAGAAAATACATTCCCAGACTT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTCTGCAGCCATGCTGTGTATGTTCTTCTGACACGCCGAAGTACCGATGTCCTGGCTGCCGAGCAAAATATTGCTCTGTTTCCTGTTGCAAGAAGCATAAAGAGGAATGCACTCTTTCATCAACTCCAGATACTGTTACCACACATATTGCCAGAGGAGAGAGATTGATGTCTAGAGAAGATGGTTTGATTGATGAAGATAATGAATCTGATAGAGTTCCTCCACACAAGCTGAAGCTTCTGGGGGAATCTGATGAGTTGAAGCATTTGCTTCTAAATCCGCATCTCAGAGAGCTTCTGATTAAGCTGGATCAGGCAGAAGAAAGAGAGGATGCAATGAAGAAATACATGCAAGAACCATTGTTTGTTGAATTTGCTGACAGATGCCTCAGCGTTGTAGAACCTGAAGAGAAAGAAAATACATTCCCAGACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCATGAAACCCCTATAAATGATTGCTATTACATGGTGCAAAGTGTTTCCTGAAAAAAAAAAAACAAAAAAACAAAATACATAGGTAAACAAAGAGGGAAAAAAAAAAAATAATTGTCTGTGATACAATAGGGGGGTGGAGGGAGATGAGTGTAGGGGTAAAAAAAAAAAAAAAAAAAAGAAAGAAGGAAGAAGGAAAGGGGGGAGGAGATAAATGGGGTGAGACAAGGAACAAGGAGGGGGGAGGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTCTGCAGCCATGCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838646
dbEST ID: 79656348
Trimmed Sequence: GTCTGGGAATCTATTTTCTTTCTCTTCAGGTTCTACAACGCTGAGGCATCTGTCAGCAAATTCAACAAACAATGGTTCTTGCATGTATTTCTTCATTGCATCCTCTCTTTCTTCTGCCTGATCCAGCTTAATCAGAAGCTCTCTGAGATGCGGATTTAGAAGCAAATGCTTCAACTCATCAGATTCCCCCAGAAGCTTCAGCTTGTGTGGAGGAACTCTATCAGATTCATTATCTTCATCAATCAAACCATCTTCTCTAGACATCAATCTCTCTCCTCTGGCAATATGTGTGGTAACAGTATCTGGAGTTGATGAAAGAGTGCATTCCTCTTTATGCTTCTTGCAACAGGAAACAGAGCAATATTTTGCTCGGCAGCCAGGACATCGGTACTTCGGCGTGTCAGAAGAACATACACAGCATGGCTGCAGAGGCATGG
Full Trace Sequence: GGGACACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTGGGAATCTATTTTCTTTCTCTTCAGGTTCTACAACGCTGAGGCATCTGTCAGCAAATTCAACAAACAATGGTTCTTGCATGTATTTCTTCATTGCATCCTCTCTTTCTTCTGCCTGATCCAGCTTAATCAGAAGCTCTCTGAGATGCGGATTTAGAAGCAAATGCTTCAACTCATCAGATTCCCCCAGAAGCTTCAGCTTGTGTGGAGGAACTCTATCAGATTCATTATCTTCATCAATCAAACCATCTTCTCTAGACATCAATCTCTCTCCTCTGGCAATATGTGTGGTAACAGTATCTGGAGTTGATGAAAGAGTGCATTCCTCTTTATGCTTCTTGCAACAGGAAACAGAGCAATATTTTGCTCGGCAGCCAGGACATCGGTACTTCGGCGTGTCAGAAGAACATACACAGCATGGCTGCAGAGGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCATTCAAAATAAAATCATTAATTTGGGCCCCGATCTTAAAAAAAAAAAAAAGATTAAAACAACAATGAATGGAAAAGAACAAAANNGCCCCCCNNAAGAAAGAGAAAGAANGGNGACCCCCCACGGGGGGGGGAGAATAGAAAGAGGATAAGATAGAGAAGGAGAAAAAAAAAAGAAGAGAAAAAGAAGGGGTTGGGGGGGGATAAAAATAANNAAGAAAAGGGCCCCCCCCCCCCCCGNAANNNNNCCCCCCNNTTTTTN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTGGGAATCTATTTTCTTTCTC