ORFeome > zp2 ORF1 – XORFeome v1.0

zp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: zp2
Gene ID: 976178
Gene Page ID: 976171
ORF Xenbase ID: 17306097

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130044
Original XGC clone length: 2100

Human orthology & disease relationships

NCBI Entrez ID: 7783
Ensembl gene IDs: ENSG00000103310
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: C09

Sequences - 5ʹ (forward) EST

Accession: JZ838518
dbEST ID: 79656220
Trimmed Sequence: ATGGGGCGTCCTGCTATGATCCCAATACATGTACCCAAATACTTCACTAAGGCCTGGTTTTTCATTTTTGGTTGCTTTTTGGTGTCACTATGTGAAGCTATGGAAACCCTTGATTTTCCAGGGTCTGTTACGTGCCTTAATGATAAAATACTGGTAAAAAAGCCCAAAGGGCTTCGCTTGAATGCTTGGCAGAATCTTCATATAGTGGATTCAGCTGGTGTTCAGATCTTAGACTGTGGTCATTTTGTGGATGGTAAAACTCTAACTGTTCCATACAAATGCACTGAATATCAGACAGGAAGGCACATCTTTCAAATTGCATTCTCCAAGAGTTCAATGGGAGAGAGAATTCTTCCCTACAGAATTAGCTGTGATGGTCTACAGGCAGATGAACCAGGATCATCAGTAGTGACCTGTACAAAAGACTCCATGACAGTAAGAATCCCACGAACTCTTTCTGGTTTTGATGATGAGATACCGGTCGCTGCACCTTCATTCTGGGACCTGGAAGTAAAATTCACAGGGCAGACTTCGTTACTCGGAATGAGCGAGGCCAGGCAAAGGGGATACCAGTTTTCAAGTGATCCTTATTATTTAACAATTCAGGCTTCCTACAGTGCGTTTGGCCTTAATGTATTCAATTTTGAAAAACCAAAGACTTTAATATGGCAAAATCTTTCTTCTGGTTTCACAGGTTTGGTTATTCCAAGGGAATTCCTATTGGACACCCCCAATGAATCCATTGCCAAAAAAATTCCTCCCCCCCCTTCAAATTCTCTACCCG
Full Trace Sequence: CGGGGGCCCATATAANTGATTTTANTTTTGACTGATAGNTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGCGTCCTGCTATGATCCCAATACATGTACCCAAATACTTCACTAAGGCCTGGTTTTTCATTTTTGGTTGCTTTTTGGTGTCACTATGTGAAGCTATGGAAACCCTTGATTTTCCAGGGTCTGTTACGTGCCTTAATGATAAAATACTGGTAAAAAAGCCCAAAGGGCTTCGCTTGAATGCTTGGCAGAATCTTCATATAGTGGATTCAGCTGGTGTTCAGATCTTAGACTGTGGTCATTTTGTGGATGGTAAAACTCTAACTGTTCCATACAAATGCACTGAATATCAGACAGGAAGGCACATCTTTCAAATTGCATTCTCCAAGAGTTCAATGGGAGAGAGAATTCTTCCCTACAGAATTAGCTGTGATGGTCTACAGGCAGATGAACCAGGATCATCAGTAGTGACCTGTACAAAAGACTCCATGACAGTAAGAATCCCACGAACTCTTTCTGGTTTTGATGATGAGATACCGGTCGCTGCACCTTCATTCTGGGACCTGGAAGTAAAATTCACAGGGCAGACTTCGTTACTCGGAATGAGCGAGGCCAGGCAAAGGGGATACCAGTTTTCAAGTGATCCTTATTATTTAACAATTCAGGCTTCCTACAGTGCGTTTGGCCTTAATGTATTCAATTTTGAAAAACCAAAGACTTTAATATGGCAAAATCTTTCTTCTGGTTTCACAGGTTTGGTTATTCCAAGGGAATTCCTATTGGACACCCCCAATGAATCCATTGCCAAAAAAATTCCTCCCCCCCCTTCAAATTCTCTACCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGCGTCCTGCTAT

Sequences - 3ʹ (reverse) EST

Accession: JZ838517
dbEST ID: 79656219
Trimmed Sequence: TTTTTTGCTTTGTATTTTATTACAAAAATTGCTCAGTGTGGATCTTCTTTTAAAAACAGATATCAGTAGCAGAGCAAACACAACCACTGCGACAAATCCAAGGATAAACAGGGCACCAACAGCAAGACGACCTACAGAACTTGTGTGATCTTTATTCTGGGTGGAGGACTCTAGATCCACAATCAGGATAGGACCTGATAGACTCACTGTAGAGGATTCTCTGTACATGGACAGCTCATCTCTTTTTCTTCTCCCCACAGAACATGTCTTAGAGCATAAAGAGAAATCAGGAGCTAGTTTGTTGCATATAATTGCATGGCAGTGAAAGTAGACCAGGTTGCTTAATACGTCACCACCCAATACAAAAGCAAAGGTCTTCACTTCAAACCTCTTCCGGTGACTTGGTCTTGCCACATTTATGCCAACAGGGTGAAAGATTGTCCAAAGATTATCCATTTCCTCTTGGCAGCCATCTACAACAACATTCCACTGGGGAGTAGAGTTTGGATTTGACGTCATTGTTGCCCAGCAATCATCCAGCACTAGTTCAATGTTTGGGTCATTGCGATTCAGAACTTGTACTTCTAGGAATATTGGGTCAAGCAAAGTTTTCACAACTGGATACTGGTTATTACTGTAGGCTGTTCCATAGGAGACATCTGGGATATACGTTGGAGTACCAGAGTAGGGGGGACCATCCGTCCTGGCGAAAAAA
Full Trace Sequence: GAAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTTTGCTTTGTATTTTATTACAAAAATTGCTCAGTGTGGATCTTCTTTTAAAAACAGATATCAGTAGCAGAGCAAACACAACCACTGCGACAAATCCAAGGATAAACAGGGCACCAACAGCAAGACGACCTACAGAACTTGTGTGATCTTTATTCTGGGTGGAGGACTCTAGATCCACAATCAGGATAGGACCTGATAGACTCACTGTAGAGGATTCTCTGTACATGGACAGCTCATCTCTTTTTCTTCTCCCCACAGAACATGTCTTAGAGCATAAAGAGAAATCAGGAGCTAGTTTGTTGCATATAATTGCATGGCAGTGAAAGTAGACCAGGTTGCTTAATACGTCACCACCCAATACAAAAGCAAAGGTCTTCACTTCAAACCTCTTCCGGTGACTTGGTCTTGCCACATTTATGCCAACAGGGTGAAAGATTGTCCAAAGATTATCCATTTCCTCTTGGCAGCCATCTACAACAACATTCCACTGGGGAGTAGAGTTTGGATTTGACGTCATTGTTGCCCAGCAATCATCCAGCACTAGTTCAATGTTTGGGTCATTGCGATTCAGAACTTGTACTTCTAGGAATATTGGGTCAAGCAAAGTTTTCACAACTGGATACTGGTTATTACTGTAGGCTGTTCCATAGGAGACATCTGGGATATACGTTGGAGTACCAGAGTAGGGGGGACCATCCGTCCTGGCGAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTTGCTTTGTATTT