ORFeome > zp4 ORF1 – XORFeome v1.0

zp4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: zp4
Gene ID: 6254438
Gene Page ID: 989712
ORF Xenbase ID: 17306103

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124975
Original XGC clone length: 1635

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ837384
dbEST ID: 79655086
Trimmed Sequence: ATGAGGTGGAATGCAAGCTCTTGGGGTTTACTGGTTGCACTGGGGTTCTGTGCTTTAGTGTCTAGTGTTCAGGGATTTTGGGATGGGTTGCGTTGTGGCCCCACAATAATGCAGTTTTCAGTCCCTTCTCTTGTACAGGATGTTGCCTTTGTGCTATCAGCTGTGGATCACTCTGGAAAATCTCACTACCTTGGCAATAACACTGCTTGTGGTACCTGGGTAGGACAGAAACCAGATGGTTCACTAGTGGTTAATGCTGCCTATGATGGGTGCTATGTTCGTGAAGAGAATGGTGACCATGTAATGACTGTTAGCCTTGAAGAGGTAATAAATGGACATGTTGACTACCATAAACAAGAACTCAAGTGCCCAATCATGGAAGCTATGGATGTTCCAAGCCCAGATACATGTTCTGCCATCAAGCGAGAAGACAGGCTTTCATGTGCTAAGGCTCCTGTATCACAAGACCTCTGTCAAGGGTTGGGATGCTGTTACACACCCAGTGATCCTTCAATGCCTTGTTACTATGGGAATAAATTGACTGCCCAGTGCACGACTGACAGCAATATGCTGGTCGCCATTTCAAAAGATCTGACCAAACCTTCATTGTCCCTGAATTCCATTAGTGTTTGTTGGGTGTGGATCAAACCTCATGCCCCTCCCTGAATGTCTCCAAGACTAATGCCCTCATCATGGTCCATTTTTCTTTGTCCTGGTGGGGCCACCAAGCGGGATGGATGGCAAACATAATTACATAGAAAAAGCAAAATTTGTTTCACCTCCAAAATTTAAAAAAACCCGGGAAGGGGTTTCTTTCAATTCCCTAGGGG
Full Trace Sequence: GGGGGCCCACATAATGGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGTGGAATGCAAGCTCTTGGGGTTTACTGGTTGCACTGGGGTTCTGTGCTTTAGTGTCTAGTGTTCAGGGATTTTGGGATGGGTTGCGTTGTGGCCCCACAATAATGCAGTTTTCAGTCCCTTCTCTTGTACAGGATGTTGCCTTTGTGCTATCAGCTGTGGATCACTCTGGAAAATCTCACTACCTTGGCAATAACACTGCTTGTGGTACCTGGGTAGGACAGAAACCAGATGGTTCACTAGTGGTTAATGCTGCCTATGATGGGTGCTATGTTCGTGAAGAGAATGGTGACCATGTAATGACTGTTAGCCTTGAAGAGGTAATAAATGGACATGTTGACTACCATAAACAAGAACTCAAGTGCCCAATCATGGAAGCTATGGATGTTCCAAGCCCAGATACATGTTCTGCCATCAAGCGAGAAGACAGGCTTTCATGTGCTAAGGCTCCTGTATCACAAGACCTCTGTCAAGGGTTGGGATGCTGTTACACACCCAGTGATCCTTCAATGCCTTGTTACTATGGGAATAAATTGACTGCCCAGTGCACGACTGACAGCAATATGCTGGTCGCCATTTCAAAAGATCTGACCAAACCTTCATTGTCCCTGAATTCCATTAGTGTTTGTTGGGTGTGGATCAAACCTCATGCCCCTCCCTGAATGTCTCCAAGACTAATGCCCTCATCATGGTCCATTTTTCTTTGTCCTGGTGGGGCCACCAAGCGGGATGGATGGCAAACATAATTACATAGAAAAAGCAAAATTTGTTTCACCTCCAAAATTTAAAAAAACCCGGGAAGGGGTTTCTTTCAATTCCCTAGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGTGGAATGCAAGCTCTTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837383
dbEST ID: 79655085
Trimmed Sequence: AGCATTTACATTGCGAGTCTTTGGGCTCCTGTTTCTATAGCGTATCCAGAGACCAATGAAAGTTACAGTTATGATCAAGACCCCTCCTATGGCTGCTGCTCCTCTTGCCCAGTGCAGTGCAGGATAACCAAAGCCGACGACACCTTCCGTTTCTATATGCTTTTCCTCTTCATTGATGAAGTCAACTGGTCCATCAGAGGTCACAGTAGTGGTCTCCAGAGGATATTCTGCAGGTTTCTCTTCAGCCATTCTGCGTTTTCTTGTGTTGCACACAATCCGGCATGTGTCAGCAGCAGATGGGATGCACACAGAAGCACTACAGTGAAAGTAAACCATGCCACCAAGAGGAAGCTGTGTAGTTCCATCCACAAATGTGAAAGTGCTGATTGAGAAGCGCTGGTAATGAGATGGGAAAGGTACAGCCTGGGAAGCAGCACCAACAGGAATCATCTGCGTCAGGTAGTTGTCTCCAGGGAAAGGACATCCATTTGTCAAGATAGGCCATTGTGGTTGTGCAGTAGAGTCAATTGGAGGGTGTAGCCCAGCATTGGTTTAAACCAGAACCACGTTTGGGTCCAGCCGCCTCAGTACTCTAACCTCCCAAAAAACAAGATCTCTGAGTATCTTGATCACCTGGTTATCCCCATCCCCATAATAATTAGTATACTTGCATGTCACAAACAAATCCCATCTCCAACATAAAAAGCCCCAAGATTAAAAAACCAGGAAGTGGGCGGGCGGAAAAGCTGGTAATACCCTCAACCCCCT
Full Trace Sequence: AAACCGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCATTTACATTGCGAGTCTTTGGGCTCCTGTTTCTATAGCGTATCCAGAGACCAATGAAAGTTACAGTTATGATCAAGACCCCTCCTATGGCTGCTGCTCCTCTTGCCCAGTGCAGTGCAGGATAACCAAAGCCGACGACACCTTCCGTTTCTATATGCTTTTCCTCTTCATTGATGAAGTCAACTGGTCCATCAGAGGTCACAGTAGTGGTCTCCAGAGGATATTCTGCAGGTTTCTCTTCAGCCATTCTGCGTTTTCTTGTGTTGCACACAATCCGGCATGTGTCAGCAGCAGATGGGATGCACACAGAAGCACTACAGTGAAAGTAAACCATGCCACCAAGAGGAAGCTGTGTAGTTCCATCCACAAATGTGAAAGTGCTGATTGAGAAGCGCTGGTAATGAGATGGGAAAGGTACAGCCTGGGAAGCAGCACCAACAGGAATCATCTGCGTCAGGTAGTTGTCTCCAGGGAAAGGACATCCATTTGTCAAGATAGGCCATTGTGGTTGTGCAGTAGAGTCAATTGGAGGGTGTAGCCCAGCATTGGTTTAAACCAGAACCACGTTTGGGTCCAGCCGCCTCAGTACTCTAACCTCCCAAAAAACAAGATCTCTGAGTATCTTGATCACCTGGTTATCCCCATCCCCATAATAATTAGTATACTTGCATGTCACAAACAAATCCCATCTCCAACATAAAAAGCCCCAAGATTAAAAAACCAGGAAGTGGGCGGGCGGAAAAGCTGGTAATACCCTCAACCCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCATTTACATTGCGAGTCTTTGG