ORFeome > zpld1 ORF1 – XORFeome v1.0

zpld1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: zpld1
Gene ID: 5829959
Gene Page ID: 5829957
ORF Xenbase ID: 17306115

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC081237
Original XGC clone length: 1248

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ839922
dbEST ID: 79657624
Trimmed Sequence: ATGGAACCAATATGGTTGTTACTGCTGTTGGCTATTTTCACAGTTTCAGTTTCTGCACAGTTTAATGGATACAACTGTGATGCCAATCAGCACAGCAGATTCCCCGCGGAAAGAGACATCACCGTCTATTGTGGAGTGCAGACAATAACAATGAAGATAAACTTTTGCACGGTTCTGTTTTCTGGATATTCAGAATCAGATCTATCACTGAATGGAAAACATGGAGATGCACATTGCAGAGGCTTCATAAACAACAATACATTTCCTGCAGTAGTTATATTTACCATCAACCTTAGCACATTGGAATCGTGTGAAAACAGCTTAGTGGTATCTACTGTTCCTGGAGTCAACGCATATGGAATTGCATCAATGGTACAAATTGGCAACATATCCGGTTATATAGATACACCAGACCCTCCAACAATTATAAGTTATCTTCCTGGACTTCTGTATAAATTTAGTTGCAGCTATCCTCTAGAGTACTTAGTAAACAACACTCAGCTTGCTTCATCTTCAGCTGCTATTTCTGTACGAGAAGGCAACGGTACATTTATCAGTACACTGAATTTACTCCTCTACAACGATTCAACCTACAGCCAGCAACTGCTAATGACCAAGTGCAGGATTGCCACTAAAAAACAAAATCTACGCAACAATAAAAACAACCAACCCTTGACGGAACGGTGGAATGTTTTAATGGACTACTGTTAACCTAACTCCTTCCGGCCAATCCCAATTGATGAAATCAAAAAAATAACCTCCTTCCCTCAACCTTCCAACAAAAAAACCACCAAAAACAAAAAATATTTTAAAAAAAAGGCCAAAA
Full Trace Sequence: CTCGGGGGCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAACCAATATGGTTGTTACTGCTGTTGGCTATTTTCACAGTTTCAGTTTCTGCACAGTTTAATGGATACAACTGTGATGCCAATCAGCACAGCAGATTCCCCGCGGAAAGAGACATCACCGTCTATTGTGGAGTGCAGACAATAACAATGAAGATAAACTTTTGCACGGTTCTGTTTTCTGGATATTCAGAATCAGATCTATCACTGAATGGAAAACATGGAGATGCACATTGCAGAGGCTTCATAAACAACAATACATTTCCTGCAGTAGTTATATTTACCATCAACCTTAGCACATTGGAATCGTGTGAAAACAGCTTAGTGGTATCTACTGTTCCTGGAGTCAACGCATATGGAATTGCATCAATGGTACAAATTGGCAACATATCCGGTTATATAGATACACCAGACCCTCCAACAATTATAAGTTATCTTCCTGGACTTCTGTATAAATTTAGTTGCAGCTATCCTCTAGAGTACTTAGTAAACAACACTCAGCTTGCTTCATCTTCAGCTGCTATTTCTGTACGAGAAGGCAACGGTACATTTATCAGTACACTGAATTTACTCCTCTACAACGATTCAACCTACAGCCAGCAACTGCTAATGACCAAGTGCAGGATTGCCACTAAAAAACAAAATCTACGCAACAATAAAAACAACCAACCCTTGACGGAACGGTGGAATGTTTTAATGGACTACTGTTAACCTAACTCCTTCCGGCCAATCCCAATTGATGAAATCAAAAAAATAACCTCCTTCCCTCAACCTTCCAACAAAAAAACCACCAAAAACAAAAAATATTTTAAAAAAAAGGCCAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACCAATATGGTTGTTACTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839921
dbEST ID: 79657623
Trimmed Sequence: ATTGAAAACTGGGTTGCGAATGCCACACAAAACCAAACTGTTTTGCTTCTTTCTGTTCAGGAGAGTTAGGGCAATTATGAAGAAAGATAAACTAGTTGCACCGAGGATTACAACTCCTGAGATGAGTGCGCTGGTGACAGAGTTTATCTGGAACTGCTGATTTCCTGGGTGAGCAAGCTGTGAATTATTTGCCGGTGTTTCATCACTTCTTGTAATGATAGGTCCTGCAGATACAACAGCATTACCAGATAAACTGTAAGGAGTTAATGTGGTTCTTATTACAGCATCTCTTCTATCTCTGTTGTGACATGTTGGTGTTAGGTAATGGCAGTCATCTGATCGGCACAGTTTTGTTATGCAGTGTAAAAACACCGTCGACATTTTCTGGTTCTTGTGCTTGACGAATCGGAACACTTCAAAGGAAAATCTTCCCATCTGACTCTTGCCATTCTCAAATATTGTTGTCTGTGGATCTTTGTCGCAGCTGAGGAAGAGGTCATATCTGATATCATCACTTGGATTGCCAGAAGGAGTAGTGTAACAGTAGTCCATTAAAACATTCCACCGTCCGTCAAGGTTGGTTGCTCTTACTGCTGCCGTAGATTTTTGTCTTTAGTGGCAATCCTGCACTTGGTATTAGCAGTTGCTGGGCTGTAGGTTGGAATCGTTTGTAAAAGGAGTAAAATCAGTGTACTGAATAAATGTACCGTTTGCCTTTCTCGTACAAAAATAACCACCCTAAAAATAAAACCAAACCCTGAATTTTTGTTTAACTTT
Full Trace Sequence: GGGGAAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTGAAAACTGGGTTGCGAATGCCACACAAAACCAAACTGTTTTGCTTCTTTCTGTTCAGGAGAGTTAGGGCAATTATGAAGAAAGATAAACTAGTTGCACCGAGGATTACAACTCCTGAGATGAGTGCGCTGGTGACAGAGTTTATCTGGAACTGCTGATTTCCTGGGTGAGCAAGCTGTGAATTATTTGCCGGTGTTTCATCACTTCTTGTAATGATAGGTCCTGCAGATACAACAGCATTACCAGATAAACTGTAAGGAGTTAATGTGGTTCTTATTACAGCATCTCTTCTATCTCTGTTGTGACATGTTGGTGTTAGGTAATGGCAGTCATCTGATCGGCACAGTTTTGTTATGCAGTGTAAAAACACCGTCGACATTTTCTGGTTCTTGTGCTTGACGAATCGGAACACTTCAAAGGAAAATCTTCCCATCTGACTCTTGCCATTCTCAAATATTGTTGTCTGTGGATCTTTGTCGCAGCTGAGGAAGAGGTCATATCTGATATCATCACTTGGATTGCCAGAAGGAGTAGTGTAACAGTAGTCCATTAAAACATTCCACCGTCCGTCAAGGTTGGTTGCTCTTACTGCTGCCGTAGATTTTTGTCTTTAGTGGCAATCCTGCACTTGGTATTAGCAGTTGCTGGGCTGTAGGTTGGAATCGTTTGTAAAAGGAGTAAAATCAGTGTACTGAATAAATGTACCGTTTGCCTTTCTCGTACAAAAATAACCACCCTAAAAATAAAACCAAACCCTGAATTTTTGTTTAACTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGAAAACTGGGTTGCGAATG